ID: 1199518220

View in Genome Browser
Species Human (GRCh38)
Location X:148703368-148703390
Sequence ACCTGTTACCAGTTCATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199518220_1199518222 28 Left 1199518220 X:148703368-148703390 CCATTCATGAACTGGTAACAGGT 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1199518222 X:148703419-148703441 ATATCTGTTTCCCACGTTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199518220 Original CRISPR ACCTGTTACCAGTTCATGAA TGG (reversed) Intronic
901412425 1:9093828-9093850 TCCTGTTAAAAGGTCATGAAGGG - Intergenic
906558645 1:46736326-46736348 GCCTGTTACCTCTTCCTGAAAGG + Intergenic
908619553 1:65962533-65962555 AACTGTTGCTAGTCCATGAAGGG + Intronic
909004576 1:70259929-70259951 TCCTGTTTCCAGGCCATGAAAGG - Intergenic
909676793 1:78247537-78247559 ACCTGTTAGCATTTCTTAAATGG - Intergenic
910106670 1:83638538-83638560 AACTGTTCCTTGTTCATGAATGG - Intergenic
910136420 1:83976838-83976860 GCTTGTTTCCATTTCATGAATGG + Intronic
910994695 1:93091554-93091576 ACCAGTTAATGGTTCATGAAAGG - Intronic
911438968 1:97900646-97900668 ACCTATTAGCAGTCAATGAATGG - Intronic
915696674 1:157749906-157749928 AACAGTTACCAGTGCATGACGGG - Intronic
918527471 1:185480551-185480573 ACCAGTTTCCAGTTCAAGAAAGG - Intergenic
919372368 1:196744277-196744299 ACCAGTTAACAGGCCATGAAAGG - Intronic
919378814 1:196828902-196828924 ACCAGTTAACAGGCCATGAAAGG - Intronic
1071713736 10:88074613-88074635 ACTGTTTCCCAGTTCATGAAGGG - Intergenic
1071857454 10:89640060-89640082 ACCTGTTATCAGTGAATGACAGG - Intronic
1079347318 11:19664280-19664302 ACCTGTATCCAGGTGATGAAGGG - Intronic
1082807371 11:57459566-57459588 GCCTGTGACCAGGCCATGAAGGG + Intergenic
1083084821 11:60131816-60131838 ACTTGTTCACAGGTCATGAACGG + Intergenic
1088143914 11:106651653-106651675 ACCTGTTTCGAGTTCAGAAATGG + Intergenic
1090742968 11:129682902-129682924 AAATGATAGCAGTTCATGAAAGG - Intergenic
1091039767 11:132266077-132266099 ACCTGTAACCAGCTCCAGAAAGG - Intronic
1091706215 12:2695222-2695244 GCCTCTTCCCAGTTCATGGAAGG + Intronic
1094165003 12:27434906-27434928 ACCTGCTACCAGGCCATGGAAGG + Intergenic
1094600841 12:31907645-31907667 TCCTGTTAAAAGGTCATGAAAGG - Intergenic
1099619118 12:84977950-84977972 CCCTGTGAGCAGTTCCTGAACGG + Intergenic
1100620634 12:96269058-96269080 ACCTGTTTCCAGCTCAAGACAGG + Exonic
1100876805 12:98970760-98970782 ATCTGTTACTACTTCCTGAAAGG + Intronic
1112238133 13:97654494-97654516 ACCTGTAGCCAGTCGATGAATGG + Intergenic
1113131897 13:107046202-107046224 ACCTATTTCCAGTTCATGGCTGG - Intergenic
1117027916 14:51640451-51640473 CCCTGTCACCAGTTCTTAAATGG + Intronic
1118245249 14:64103988-64104010 ACCTGATACGATTTCATGAGTGG + Intronic
1120913040 14:89685136-89685158 ACAGTTTCCCAGTTCATGAAAGG + Intergenic
1121040111 14:90739425-90739447 ACCTGGTTCCAGTTCAAGACCGG + Intronic
1125088334 15:35758823-35758845 ACCTTGTTCCACTTCATGAAGGG + Intergenic
1127254964 15:57282022-57282044 AAATGTTACCAGTTCAGAAAAGG - Intronic
1131999113 15:98162209-98162231 ACCTGTTGCCACTTCATGCCTGG - Intergenic
1134748849 16:16609650-16609672 ATCTGTTACCAGGTCATTACCGG + Intergenic
1134996616 16:18743968-18743990 ATCTGTTACCAGGTCATTACCGG - Intergenic
1136041311 16:27581373-27581395 ATCTTTTAACAGTGCATGAAAGG + Intronic
1137916019 16:52431055-52431077 CCCTGATAGCACTTCATGAAGGG - Intergenic
1138796478 16:59975870-59975892 ACATGTTACCAGCTCATGTCTGG + Intergenic
1140133447 16:72184141-72184163 ACCTGGGACCATTTCAGGAATGG - Intergenic
1142295828 16:89221423-89221445 GCCTGTTACCATTTCCTGATGGG + Intronic
1144400037 17:14887158-14887180 CCATGTTACCAGGTCATCAAAGG + Intergenic
1151708247 17:75784104-75784126 ACTTGTTTCCAGTACATTAAGGG - Intronic
1153676471 18:7460110-7460132 ACCTGTTGCCTGTTCACAAAGGG - Intergenic
1155047346 18:22114367-22114389 TTCTGTTTCCAGTTCATCAACGG - Intergenic
1156213424 18:34972754-34972776 ACAGGTTACCAGTTCAAGGAAGG - Intergenic
1163131933 19:15279577-15279599 ACCTGTTCCCAGACCAGGAAAGG + Intronic
1164626453 19:29731735-29731757 ACCTGTCACCAGGTCTTCAAGGG + Intergenic
1165004035 19:32789658-32789680 AACTGTTATCAGCTGATGAATGG - Intronic
928316101 2:30247756-30247778 ACTTTTTACCACTTCATCAAGGG + Intronic
930032874 2:47069158-47069180 ACCTGATACCAGCCCAGGAAGGG + Intronic
933951653 2:87335537-87335559 ACCTGTGACTACTTGATGAAGGG - Intergenic
934134409 2:88981930-88981952 ACCTGTGACTACTTGATGAAGGG + Intergenic
934137681 2:89013044-89013066 GCCTGTGACAAGTTGATGAAAGG + Intergenic
934235897 2:90231847-90231869 ACCTGTGACTACTTGATGAAGGG - Intergenic
935610486 2:105018953-105018975 TCCTTTTAGCAGTTCTTGAAGGG - Intergenic
937558493 2:123190449-123190471 ACCTGGTACCATTTGGTGAAGGG - Intergenic
939571112 2:143840848-143840870 ACCTGTTACCATTTTACCAATGG + Intergenic
941489678 2:166127559-166127581 ACCTGATTTCAGTTCATGGAAGG + Intronic
941589258 2:167398621-167398643 AAGTGTTAACAGTTCATGAGAGG + Intergenic
948416896 2:237813926-237813948 ACCTGTCAGCAGTTCTTGAAAGG - Intronic
1170798923 20:19574339-19574361 ATCTGTTACCTGTACATCAAAGG + Intronic
1171789972 20:29514560-29514582 ACCAGTTACCAATAAATGAAAGG + Intergenic
1175364153 20:58439787-58439809 ACTTGTGACCAGTTGAAGAAAGG + Intronic
1176703615 21:10091186-10091208 TCCTGTTGCCAGTTGCTGAAAGG - Intergenic
1178328210 21:31662545-31662567 ACCTGTCACCATTACCTGAATGG + Intronic
1178771988 21:35513831-35513853 CCATGTTTCCAGTTCAAGAAGGG - Intronic
1180390671 22:12279670-12279692 ACCAGTTACCAATAAATGAAAGG + Intergenic
1180409072 22:12585087-12585109 ACCAGTTACCAATAAATGAAAGG - Intergenic
1180726059 22:17947316-17947338 CCCAGTTACCTCTTCATGAAGGG - Intronic
951179530 3:19643017-19643039 ACCTGTTAGCAATGCACGAAAGG + Intergenic
951441563 3:22729359-22729381 ACATGTTCCCAGGTGATGAATGG - Intergenic
957026958 3:75193090-75193112 ACCTGTGACTAGTTTCTGAAGGG - Intergenic
958163285 3:89846459-89846481 GCCTGTTTCCAGTTCATAGATGG - Intergenic
959128787 3:102324919-102324941 ACCTGTTACTGATTCATGGATGG - Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
965261053 3:166485941-166485963 ACCGATTACCAGCTCAAGAATGG + Intergenic
965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG + Intronic
970130529 4:12864885-12864907 ACCTGTTACCACTACTTTAATGG - Intergenic
970938081 4:21598096-21598118 ACCGGTTACCATTAAATGAAAGG + Intronic
971686894 4:29782016-29782038 ACCTGTTTACAGTAAATGAAAGG + Intergenic
972741983 4:41895618-41895640 ACCTCTTACAATTCCATGAAAGG - Intergenic
972814640 4:42630464-42630486 AACTGTTACCAGATCAAGAACGG - Intronic
975042066 4:69758133-69758155 ACATGTTAGCAGCTCAAGAAAGG + Intronic
975977170 4:80112790-80112812 ACCTGTTACAAGTCCAAGGATGG + Intronic
976268325 4:83205946-83205968 TCCTGTTAAAAGGTCATGAAGGG - Intergenic
976778497 4:88732577-88732599 ACCAGTAACCAGTGCTTGAAAGG + Intronic
978411408 4:108430097-108430119 AGCTGTCAACAGTTCATAAAAGG - Intergenic
982714738 4:158795068-158795090 CCCTGATACCAGTTCTTAAACGG - Intronic
983123584 4:163920163-163920185 ACCACTTACCATTTCATAAATGG - Intronic
983342020 4:166473618-166473640 ACCTGATACAATTTTATGAAAGG - Intergenic
986387224 5:7246678-7246700 ACATTTTACCAGTTCCTTAATGG + Intergenic
991291431 5:65036920-65036942 TCCTTTTCCCACTTCATGAAAGG + Intergenic
991353530 5:65745007-65745029 ACCTATGAACAGTTCATTAAAGG + Intronic
996149626 5:120019723-120019745 ACCCCTTTCCATTTCATGAATGG - Intergenic
997801462 5:136866714-136866736 ACATATTACCTGCTCATGAATGG + Intergenic
997920518 5:137974821-137974843 ACCTGTTGCCAGTTTTTGCATGG + Intronic
1000611252 5:163377900-163377922 AACTGTTGCCAGTTACTGAAGGG - Intergenic
1001395453 5:171416408-171416430 AGCTGTTACCAGTCCAGGTAAGG - Intergenic
1005011770 6:21342614-21342636 TGCTGTTAGCAGTTCATGACTGG - Intergenic
1008242920 6:49134268-49134290 ATTTGCTACCAGTTCTTGAAAGG - Intergenic
1008339843 6:50351611-50351633 ACTTCTTACAAGTTCTTGAAGGG + Intergenic
1012897800 6:104971610-104971632 ACCTGATCCTAGTTCTTGAAAGG - Intronic
1015412160 6:132906018-132906040 AAGTGTTACCAGTTCACCAATGG - Intergenic
1018262535 6:161984780-161984802 TGCTGTTAGCATTTCATGAAGGG + Intronic
1018338650 6:162824990-162825012 AACTTTTGCCAGTTCATAAATGG + Intronic
1019145471 6:169972923-169972945 ACCTTTTACCAATTCAGGATGGG + Intergenic
1020354025 7:7257399-7257421 ACCTGTTTCCAGGTCACCAAAGG + Intergenic
1020411001 7:7891393-7891415 TCCTGATATCAGTTGATGAATGG + Intronic
1020607476 7:10356934-10356956 AGCTGGTACCAGTGCATGGAGGG - Intergenic
1021294055 7:18881888-18881910 ACCAGGTACCACTTCATGAAGGG + Intronic
1025242580 7:57290112-57290134 ACCTGTTACTAATTCAAGAAGGG - Intergenic
1027477423 7:78650575-78650597 CCCTGTAACCACTTCATTAAAGG - Intronic
1032258315 7:130314472-130314494 TCCTGTTAAAAGGTCATGAAGGG + Intronic
1039814897 8:41084671-41084693 ACCTTTTTCTTGTTCATGAATGG + Intergenic
1042778285 8:72460264-72460286 TACTGATACCAGTTCATGCAGGG + Intergenic
1042826319 8:72983556-72983578 GCCTGTTACCATTTCATAGATGG - Intergenic
1046633800 8:116649656-116649678 ACCTGTTTGCAGTTAATGAATGG - Intronic
1048011363 8:130459074-130459096 ACCTGTGATGAGTACATGAATGG - Intergenic
1048692726 8:136986212-136986234 ACCTATTACCAGTGCATGTGGGG + Intergenic
1050943781 9:11492365-11492387 AGCTGTTATCAATTCATTAATGG + Intergenic
1051020058 9:12532985-12533007 AGGTGTAACCAGTTCATAAAGGG + Intergenic
1052107737 9:24540351-24540373 AAATATAACCAGTTCATGAAGGG + Intergenic
1056027282 9:82512082-82512104 ACCAGTTCCCAGATCCTGAAAGG + Intergenic
1056217922 9:84422539-84422561 ACCTGCTAATATTTCATGAAAGG - Intergenic
1058886537 9:109325858-109325880 ACCTGCTACCGGCTCAAGAATGG + Intergenic
1060024577 9:120160474-120160496 ACCTGTTACCTGGGCAGGAAGGG - Intergenic
1202788652 9_KI270719v1_random:61281-61303 TCCTGTTGCCAGTTGCTGAAAGG - Intergenic
1186464054 X:9770677-9770699 TCTTGTGGCCAGTTCATGAATGG + Intronic
1189614438 X:42769080-42769102 CCCTGTTAAAAGGTCATGAAGGG - Intergenic
1194186758 X:90780388-90780410 AATTGTTACCAGTACATGAGGGG + Intergenic
1194207569 X:91030000-91030022 TCCTGTTTCCAGGTGATGAATGG - Intergenic
1194783944 X:98058544-98058566 AGCTGATACCAGCTCATGGAGGG - Intergenic
1195485273 X:105397459-105397481 AGCTATTACTAGTTTATGAAAGG + Intronic
1195506615 X:105665465-105665487 ACCTGTTACCTCTTTATGGATGG + Intronic
1196608535 X:117684567-117684589 ACCTTTTACAAGTCCATGAAAGG + Intergenic
1199518220 X:148703368-148703390 ACCTGTTACCAGTTCATGAATGG - Intronic
1199748671 X:150793870-150793892 ACCTCTTAGAATTTCATGAAGGG - Intronic
1200553366 Y:4605046-4605068 TCCTGTTTCCAGGTGATGAACGG - Intergenic