ID: 1199523883

View in Genome Browser
Species Human (GRCh38)
Location X:148769763-148769785
Sequence CAAGTTAAGGAGAAGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199523883_1199523888 4 Left 1199523883 X:148769763-148769785 CCAGACCCCTTCTCCTTAACTTG 0: 1
1: 0
2: 0
3: 15
4: 261
Right 1199523888 X:148769790-148769812 TATATTTCAGACTGACTCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199523883 Original CRISPR CAAGTTAAGGAGAAGGGGTC TGG (reversed) Intronic
900423136 1:2564360-2564382 CAAGGAAAGGAGAGGGGGTAGGG - Intronic
902378450 1:16041456-16041478 CAAGTGAAGGGGAAGGGACCTGG + Intergenic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903431442 1:23304239-23304261 CAAGTGAAGGAGAAGTGGTGAGG - Intronic
903708339 1:25303378-25303400 CAAGCCACGGAGAAGGGATCAGG - Exonic
903718775 1:25389035-25389057 CAAGCCACGGAGAAGGGATCAGG + Exonic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905140933 1:35843737-35843759 ACAGTTAAGGAGAAGGTGGCAGG - Intronic
907359868 1:53905872-53905894 CACGTTGAAGAGCAGGGGTCTGG + Intronic
907513898 1:54981144-54981166 CGAGGTTAGGGGAAGGGGTCGGG - Intronic
910860844 1:91741335-91741357 CAAGGTACGGGGAAGGGGTGAGG + Intronic
912296269 1:108473932-108473954 AGAGTGAAGGAGAAGGGGTTGGG - Intergenic
918174679 1:182032643-182032665 CAAGTACAGCAGATGGGGTCAGG - Intergenic
918217945 1:182409314-182409336 CAAGTGGAGGACAAGGGGTTGGG + Intergenic
918699300 1:187587601-187587623 CAAGCCAAGGAGAAAGGCTCAGG - Intergenic
919806330 1:201382905-201382927 CCAGCTAAGGAGATGGGCTCAGG + Intronic
921570287 1:216769725-216769747 CAAGTTAAGGACAAATTGTCAGG + Intronic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1065953407 10:30673004-30673026 AAAGTGATGGAGAAGGGGCCAGG - Intergenic
1066149841 10:32604994-32605016 CCAGTTTTGGAGATGGGGTCTGG + Intronic
1066710990 10:38233668-38233690 TAAGTTGAGGAGAAAGAGTCGGG - Intergenic
1068167824 10:53354215-53354237 CAATTGAAGGTAAAGGGGTCAGG - Intergenic
1068868927 10:61923064-61923086 GAACTTAAAGAAAAGGGGTCTGG + Intronic
1074859975 10:117502688-117502710 CCAGGTATGCAGAAGGGGTCTGG + Intergenic
1075226815 10:120637045-120637067 CAAATCAAGGAAGAGGGGTCTGG + Intergenic
1075913478 10:126146405-126146427 CTAGTTAGGGAGGAGGAGTCAGG + Intronic
1077795608 11:5488740-5488762 CCTGTTAAGAAGAAGGTGTCTGG - Exonic
1079792623 11:24757024-24757046 CAAGTTATGGGGAAGGGGCATGG + Intronic
1079925024 11:26483373-26483395 CCAGTTCTGGAGGAGGGGTCTGG + Intronic
1080877403 11:36289343-36289365 CAAGGTAAGTCGAAGGGGTGGGG - Exonic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084452912 11:69250721-69250743 AAAGGAAAGGAGAAGGGGTGCGG - Intergenic
1084938930 11:72602017-72602039 CAAGTTTCAGAAAAGGGGTCTGG - Intronic
1087256810 11:95965189-95965211 CCACTAAAGGAGAAGGGATCTGG + Intergenic
1088381742 11:109200651-109200673 CAAGTAAAGGAAAGGGGGTAAGG - Intergenic
1089115856 11:116094517-116094539 CAAGTCAAGGAGAAAGCCTCAGG + Intergenic
1089446598 11:118557779-118557801 CAAGTACATGAGAAGGGGTCTGG + Exonic
1089759050 11:120709458-120709480 GAAGATAAGGAGAAGGGCTGGGG - Intronic
1089987177 11:122825379-122825401 AGAGTGAAGGAGAAGGGGTTGGG - Intergenic
1090226647 11:125075901-125075923 CCAGTCCAGGAGAAGGGGCCAGG - Intronic
1090881085 11:130831779-130831801 CAAGTTTCGGAGCAGGGGTGGGG - Intergenic
1091164747 11:133465276-133465298 CAAGGTAAGGAGGAGGGTTATGG - Intronic
1091370779 11:135056331-135056353 CTAGACAAGGAGATGGGGTCAGG - Intergenic
1092474254 12:8805818-8805840 AGAGTGAAGGAGAAGGGGTTGGG - Intergenic
1092979448 12:13779012-13779034 CAAGTTACAGAGCAGGGGTTGGG - Intronic
1093705080 12:22266129-22266151 GAAAGTAAGGAGAAGGGGTGAGG - Intronic
1094196534 12:27755827-27755849 CAAGTCAAGGAAATGGGTTCTGG - Exonic
1095054346 12:37582050-37582072 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1096191821 12:49624288-49624310 GAAGTTTAGGAGAATGGGTTTGG + Intronic
1097455762 12:59796547-59796569 CCAGTCAGGGAGCAGGGGTCTGG - Intergenic
1097655674 12:62359547-62359569 CAAGTTAAGCAGAATGACTCTGG + Intronic
1099292318 12:80787928-80787950 AGAGTGAAGGAGAAGGGGTTGGG + Intergenic
1101372380 12:104141139-104141161 CTACTTAAGAAGAAGGGATCAGG - Intergenic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1103811088 12:123614501-123614523 CCAGTTAAGGAAAAGGGTCCAGG + Intronic
1104538384 12:129640146-129640168 CAAGTGAAGGAGAAATGGTAGGG - Intronic
1106698536 13:32204599-32204621 GAAGTTAGGAAGAAGGGGTGAGG - Intronic
1108367646 13:49731845-49731867 CAAATTAAGAATAAGGGGACAGG - Intronic
1108411488 13:50152571-50152593 CAAGTTAGTGAGAATAGGTCTGG - Intronic
1114068294 14:19085727-19085749 CCAGTGTAGGAGGAGGGGTCTGG + Intergenic
1114093970 14:19314298-19314320 CCAGTGTAGGAGGAGGGGTCTGG - Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115747388 14:36451542-36451564 CCAGTTTAGGAGGAGAGGTCAGG - Intergenic
1118704544 14:68468706-68468728 CAAGATAACCAGAAGGAGTCAGG - Intronic
1119022184 14:71125163-71125185 AGAGTGAAGGAGAAGGGGTTGGG - Intergenic
1119914021 14:78379418-78379440 CAAGTAAAGTAGAAGGGTGCAGG + Intronic
1120133264 14:80832674-80832696 CAAGCAAAGGAGAAGGAGTTGGG + Intronic
1120438279 14:84505009-84505031 AAGGTGAAGGAGAAGGGGTTGGG + Intergenic
1120757760 14:88259849-88259871 CCAGTGTAGGAGAAGGGGTATGG + Intronic
1121277138 14:92676205-92676227 CTAGGAAAGGGGAAGGGGTCAGG + Intronic
1126843533 15:52739534-52739556 AAGGTGAAGGAGAAGGGGTTGGG - Intergenic
1126994445 15:54424518-54424540 CAAATTGAGGAGAAGGGGAAAGG + Intronic
1128776729 15:70326166-70326188 CAAGTTTGGGAGCCGGGGTCAGG + Intergenic
1128878327 15:71220703-71220725 CAAGTGCAGCAGAAGGGATCAGG + Intronic
1129677117 15:77637676-77637698 GACTTTAAAGAGAAGGGGTCAGG - Intronic
1130313122 15:82771858-82771880 CAAGGCCAGGCGAAGGGGTCTGG - Intronic
1130366751 15:83247778-83247800 CAAGTTAAGGAGAATGGTAAGGG - Intergenic
1130607432 15:85330772-85330794 TAAGTTAAGGCGAATGGGTCCGG + Intergenic
1131200227 15:90389291-90389313 GTAGGTAAGGAGAAGGGGCCTGG + Intronic
1133576657 16:7097846-7097868 TGAGTTAGGGAGAAGGGGTTGGG + Intronic
1135612341 16:23879393-23879415 CATGTCAAGGAGAAGGTGCCTGG - Intronic
1136637103 16:31531340-31531362 CAAGTTGAGGATCAAGGGTCAGG - Intergenic
1137529999 16:49273322-49273344 CAAGCTAATGAATAGGGGTCAGG + Intergenic
1137901400 16:52272940-52272962 CAAGGTATGGAAAAGGGGTGTGG - Intergenic
1138596438 16:58031586-58031608 CAAGTTAAGGAGTGTGGGGCAGG + Intronic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1140226168 16:73079139-73079161 TAAGTGAAAGAGAAGGGGACTGG - Intergenic
1140559408 16:75960583-75960605 AATGTCAAGGAGAAGGGGTCAGG - Intergenic
1140673671 16:77304547-77304569 CAAGTTTAGGAAAAGGGATGTGG - Intronic
1141195277 16:81855976-81855998 CAAATTAAGAACAGGGGGTCAGG - Intronic
1141466010 16:84206232-84206254 CAAAGTAAGGAGATGAGGTCAGG - Intergenic
1141480107 16:84300672-84300694 TAAGAAAAGGAGAAGGGGCCAGG + Intronic
1141685103 16:85565697-85565719 CAGGGTCAGGTGAAGGGGTCAGG - Intergenic
1144456517 17:15423287-15423309 CAAGTTAAGGATAAGGAAGCTGG + Intergenic
1145257554 17:21335160-21335182 TAAGTTATGGGGAAGGGGTGTGG + Intergenic
1145319085 17:21752875-21752897 TAAGTTATGGGGAAGGGGTGTGG - Intergenic
1146966312 17:37033971-37033993 CAAGCAAGGGAGAAGGGGTTAGG + Intronic
1147122734 17:38345230-38345252 GAAGAAAAGGAGAAGGGGCCAGG - Intergenic
1147744543 17:42687225-42687247 CTAGTTAAGAAGCAGTGGTCGGG + Intronic
1148894401 17:50831568-50831590 CAGGTTTAGGAGATGGGGTGGGG - Intergenic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1152019181 17:77771607-77771629 CAAGCCAAGGTCAAGGGGTCAGG + Intergenic
1152126520 17:78450535-78450557 CCAGGGCAGGAGAAGGGGTCTGG - Intronic
1157075210 18:44458415-44458437 CAAGTTAAGGGTATGGGTTCTGG + Intergenic
1157919421 18:51699479-51699501 CATGTAAAGGAAAAGAGGTCTGG - Intergenic
1158394875 18:57071479-57071501 AGAGTGAAGGAGAAGGGGTTGGG + Intergenic
1159437377 18:68436440-68436462 CACACTAAGGAGAAAGGGTCTGG + Intergenic
1159550124 18:69885933-69885955 CAAGTTTAGGCAAAGGAGTCGGG - Intronic
1160827320 19:1086676-1086698 CAAGCTTAGAAGAAGGGGCCAGG + Exonic
1161719209 19:5894014-5894036 CCAGTTCTGGAGAAGGGGCCCGG + Intronic
1165573026 19:36791484-36791506 CAAATTACGGAGGAGGGGGCAGG - Intergenic
1165632347 19:37312502-37312524 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1165979658 19:39709401-39709423 CAAGTGTAGGGGAAGGGGTGAGG - Intronic
1166372916 19:42312379-42312401 CAAGTGAAAAAGTAGGGGTCAGG + Intergenic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167558035 19:50207630-50207652 CATTTTATGGAGAAGGAGTCAGG + Intronic
1167777292 19:51566750-51566772 CATGTTTGGAAGAAGGGGTCAGG + Intergenic
1167941506 19:52949272-52949294 AATGTTAAGAAGAATGGGTCAGG - Intronic
1168228182 19:55011459-55011481 AGAGTGAAGGAGAAGGGGTTGGG + Intergenic
925263111 2:2545273-2545295 CAAGTTCAGGAAAAGGGGAAAGG + Intergenic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
925705732 2:6683341-6683363 AAATTTAAGGCAAAGGGGTCTGG + Intergenic
926633413 2:15157752-15157774 CATGGAAAGAAGAAGGGGTCTGG + Intergenic
928039405 2:27859598-27859620 CAAGTGAAGAAGATGGGCTCAGG + Intronic
928248441 2:29652823-29652845 CAAGGTATGGGGAAGGGGTGTGG - Intronic
928425750 2:31176497-31176519 CTTGTGAAGGAGAAGGGCTCTGG - Intronic
928601548 2:32908653-32908675 CAAGTTATGGAGAAGGGGAATGG - Intergenic
931438168 2:62266941-62266963 CACGTTAAGGAGTAAGGGTGCGG + Intergenic
932295610 2:70621445-70621467 AGAGTGAAGGAGAAGGGGTTGGG - Intronic
932295642 2:70621567-70621589 AGAGTGAAGGAGAAGGGGTTGGG - Intronic
933900039 2:86842992-86843014 CAAGTTAAAATGAAGGGGTGGGG + Intronic
934684749 2:96312769-96312791 CTAATTAAGGAAAAGGAGTCAGG + Intergenic
935369690 2:102332276-102332298 CAGGTTAAGGAGATGGGGATTGG + Intronic
935780519 2:106506233-106506255 CAAGTTAAAATGAAGGGGTGGGG - Intergenic
937497087 2:122432046-122432068 CGAGTTAAGGAGGAGGAGTAGGG + Intergenic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
938544073 2:132311551-132311573 CAATGTAGGGAGAAGGGGTTAGG - Intergenic
939100560 2:137890600-137890622 AAAGTTGATAAGAAGGGGTCTGG - Intergenic
942021397 2:171869702-171869724 CAACTCAAGGAGAAGGGCTTTGG - Intronic
943077039 2:183208396-183208418 CAAGCCAAGGAGAAGGGAACCGG - Intergenic
943707107 2:191047192-191047214 CAAGGCATGGAGAAGGGGTGTGG - Intronic
944689587 2:202147471-202147493 CCAGTGGAGGGGAAGGGGTCAGG + Intronic
946314831 2:218904073-218904095 CAAGTTAAGGAGAACTGGTTTGG - Intergenic
1171527913 20:25830297-25830319 CAAATTATGGAGGAGGGGGCAGG - Intronic
1171548913 20:26025583-26025605 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1172519281 20:35556791-35556813 CAAGACTAGGAGAGGGGGTCTGG + Intronic
1172972779 20:38885604-38885626 CAAATTAAGGAGCAGGGATTTGG - Intronic
1176070974 20:63226333-63226355 CAAGCTGAGGAGGAGGGGACCGG + Intergenic
1176077799 20:63256357-63256379 CGAGTTCTGGTGAAGGGGTCAGG + Intronic
1176922808 21:14708772-14708794 CAAGGCAAGGAGAAGGTGACTGG - Intergenic
1180486766 22:15808289-15808311 CCAGTGTAGGAGGAGGGGTCTGG + Intergenic
1182305380 22:29364404-29364426 AAAATAAAAGAGAAGGGGTCAGG - Intronic
1184061555 22:42085458-42085480 CAAATGATGGAGAAGGGGTTTGG - Intergenic
1185082427 22:48717404-48717426 GAAGATGAGGGGAAGGGGTCAGG + Intronic
949980082 3:9497045-9497067 GAAGTTAGGCAGGAGGGGTCAGG - Intergenic
950189625 3:10967596-10967618 AATGCTATGGAGAAGGGGTCAGG + Intergenic
950603383 3:14056548-14056570 AAAGTTAAGATGAAGGAGTCAGG - Intronic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
958484710 3:94690123-94690145 CAAGTGAAGGGGAAGGAGTGTGG - Intergenic
958558873 3:95717231-95717253 CAAGTTAAAGAGAAAGGGACAGG - Intergenic
958732513 3:97974121-97974143 GAAGAAAAGGAGAAGGGGCCAGG + Intergenic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
960692004 3:120356390-120356412 CAAGTTAAGGAAATGGGATCTGG - Intergenic
961097719 3:124172239-124172261 CAAGGTAAGGCGAAGGGGAATGG - Intronic
961105202 3:124234940-124234962 CAAGGTAAGGGGAAGGGGAATGG + Exonic
962710594 3:138082333-138082355 CAAGTTAAGGCAAAGAGCTCTGG + Intronic
963560759 3:146862195-146862217 CAAGTTAAGGGGAAGGTCTTTGG - Intergenic
964983453 3:162713452-162713474 AGGGTGAAGGAGAAGGGGTCGGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965626561 3:170688236-170688258 AGAGTGAAGGAGAAGGGGTCAGG + Intronic
967244379 3:187471034-187471056 AAAGTGAAGGAGAAGGGGTTGGG + Intergenic
967389894 3:188945352-188945374 CAAGGTGGGGAGAAGGGTTCAGG - Intergenic
967718576 3:192790727-192790749 CAATATAAGGAGACTGGGTCTGG + Intergenic
971453878 4:26825659-26825681 CTAGTTAAGTAAAAGGGGTTTGG + Intergenic
972136446 4:35900391-35900413 CAAGTCAGCAAGAAGGGGTCAGG + Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
973146694 4:46834631-46834653 CAAGTGAAGAAGAAAGTGTCGGG - Intronic
976255120 4:83092113-83092135 CAAGTTGATGAGGAGGAGTCAGG + Intronic
979269421 4:118742789-118742811 TCACCTAAGGAGAAGGGGTCAGG - Intronic
979755751 4:124338507-124338529 CAAGCTAAGGAGAAGGGAAAGGG + Intergenic
980174962 4:129333413-129333435 CCTGTTAAGAAGAAGGGGCCTGG + Intergenic
982498784 4:156128316-156128338 AAAGTTTAGGAAAAGAGGTCAGG + Intergenic
982707538 4:158726344-158726366 GTAGTTAAGGATAAGGGGCCAGG - Intergenic
982715187 4:158799490-158799512 CAAGTAAGGTAGAAGGTGTCTGG - Intronic
983023667 4:162710132-162710154 AGGGTTAAGGAGAAGGGGTTGGG - Intergenic
983460901 4:168024921-168024943 CAAATTAGGGAAAAGGAGTCAGG + Intergenic
983720456 4:170845250-170845272 GAAGAGAAGGAGAAGGTGTCAGG + Intergenic
985707711 5:1411111-1411133 CAAGTCAAGGACAGGAGGTCTGG + Intronic
987174057 5:15289099-15289121 CAAGTAAAGGAAATGGGGTGGGG - Intergenic
993037478 5:82773590-82773612 CAAGGAATGGAGAAGTGGTCTGG + Intergenic
993559185 5:89382675-89382697 CCAATTTTGGAGAAGGGGTCTGG + Intergenic
993603299 5:89955442-89955464 CAAGTCCAGGAGCAGGGGTGTGG + Intergenic
994589432 5:101755010-101755032 CCAGTTTTGGAGGAGGGGTCTGG + Intergenic
994775490 5:104032655-104032677 AAGGTGAAGGAGAAGGGGTTGGG - Intergenic
995666062 5:114544233-114544255 AATGTTAAGGAGAAGGGGCAGGG + Intergenic
995899618 5:117051266-117051288 AGAGTGAAGGAGAAGGGGTTGGG + Intergenic
995960274 5:117830336-117830358 AATGTTAAGGAGAAGGGGCAGGG - Intergenic
997548348 5:134730295-134730317 CTAGTTCTGGAAAAGGGGTCAGG - Intergenic
997872274 5:137516542-137516564 CAAGTTCAGGAGGAGGGGCAGGG + Intronic
997872299 5:137516637-137516659 CAAGTTCAGGAGGAGGGGCAGGG + Intronic
997872337 5:137516804-137516826 CAAGTTCAGGAGGAGGGGCAGGG + Intronic
997872376 5:137516962-137516984 CAAGTTCAGGAGGAGGGGCAGGG + Intronic
997872469 5:137517431-137517453 CGAGTTCAGGAGAAGGGGCAGGG + Intronic
1000068938 5:157721122-157721144 CATGGGAAGCAGAAGGGGTCAGG + Intergenic
1000201538 5:159015609-159015631 GAAGTTAAGGAGCAGAGGTCTGG - Intronic
1000991865 5:167919539-167919561 TAAGTAAAGGAGAAGAGCTCAGG + Intronic
1001331700 5:170766899-170766921 AGAGTGAAGGAGAAGGGGTTGGG + Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1003017388 6:2478862-2478884 CAAGGGAAGGAGAATGGGCCAGG + Intergenic
1004105992 6:12668128-12668150 AGAGTGAAGGAGAAGGGGTTGGG - Intergenic
1004106025 6:12668249-12668271 AGAGTGAAGGAGAAGGGGTTGGG - Intergenic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1004768813 6:18758920-18758942 AGAGTGAAGGAGAAGGGGTTGGG + Intergenic
1007147750 6:39653719-39653741 GAAGTTAGGGAGAAGTGGTGGGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007388312 6:41534409-41534431 AAAGAAAAAGAGAAGGGGTCTGG + Intergenic
1010155292 6:72785351-72785373 CAAGAACAGGAGCAGGGGTCAGG + Intronic
1012258456 6:97060792-97060814 CAAGTGCAGGAGAAGGGGATGGG - Intronic
1013044082 6:106466743-106466765 CAAGTTAAGTAGAATGTGTTTGG + Intergenic
1013408114 6:109860598-109860620 AGAGTGAAGGAGAAGGGGTTGGG + Intergenic
1014303371 6:119711258-119711280 CAAGCTGAGGAGGAGGGGTTTGG - Intergenic
1015744748 6:136497976-136497998 AAAGTTAAGGATATGTGGTCAGG - Intronic
1015846250 6:137523685-137523707 CAAGTGCAGGAGATGGGGGCGGG - Intergenic
1017622442 6:156313361-156313383 CCACTTAAGGGGGAGGGGTCTGG - Intergenic
1018606020 6:165598877-165598899 CAAGATGAGGGGACGGGGTCAGG + Intronic
1025297730 7:57789586-57789608 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1026461722 7:70620565-70620587 CAATTCAAGGAGAAGCAGTCAGG - Intronic
1028325097 7:89513921-89513943 CAAGTTAAGATGAAGGTGCCTGG + Intergenic
1030121707 7:106116468-106116490 CTAATTCAGGAGAAGGAGTCAGG - Intergenic
1030345010 7:108423301-108423323 AAAGTGAAGGAGAAAGAGTCAGG + Intronic
1030803634 7:113886571-113886593 CAAATTAGGGAGAAGGAATCAGG + Intronic
1031338861 7:120573593-120573615 CAAGTGAAGGAAAAGGGTTTGGG + Intronic
1031776103 7:125910889-125910911 AGAGTGAAGGAGAAGGGGTTGGG - Intergenic
1032842333 7:135724168-135724190 CAAGTTAAGGGGAAGGAGGTGGG + Intronic
1036180365 8:6579293-6579315 CAAATGGAGGAGAAGGGGACCGG - Intronic
1039119451 8:34129569-34129591 AAAGTCAAGGAGGAGTGGTCTGG + Intergenic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1040365426 8:46710254-46710276 CACCTTAAGGTGAGGGGGTCAGG + Intergenic
1041117727 8:54556200-54556222 CAAGTCAAGCAGCAGGGGGCAGG - Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041980550 8:63853545-63853567 TAAGTGAATGGGAAGGGGTCAGG + Intergenic
1042070847 8:64931503-64931525 CAAGAGAAGCACAAGGGGTCAGG - Intergenic
1042561280 8:70073496-70073518 CTAGTTGAGGGGAAGGGGCCGGG - Intergenic
1043005030 8:74808430-74808452 GCAGTTTAGGAGAAGGGGTTAGG - Intronic
1043704572 8:83332007-83332029 CAAGTTATGGATAAGTGGACAGG + Intergenic
1044043123 8:87395357-87395379 CAAGTTATGGAGAAGAGGGAAGG + Intronic
1044064485 8:87682733-87682755 GAAAGTGAGGAGAAGGGGTCTGG + Intergenic
1045745313 8:105412204-105412226 AAAATGAAGGGGAAGGGGTCAGG - Intronic
1045935970 8:107679203-107679225 CAAGTTAAGATGAAGGGATTAGG - Intergenic
1047371322 8:124258297-124258319 CAAGTTAGGGGGAAGGAGGCTGG - Intergenic
1049491540 8:142905972-142905994 TAAGTTAAGGAGAAGTGTCCTGG - Intronic
1051112154 9:13651376-13651398 CCAGGGAAGCAGAAGGGGTCGGG - Intergenic
1052685928 9:31756244-31756266 CAAGTTAAAAGGAAGGGGTTGGG - Intergenic
1053795877 9:41726445-41726467 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054149302 9:61588428-61588450 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054184284 9:61938516-61938538 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054469064 9:65519539-65519561 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054654222 9:67649979-67650001 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054694741 9:68348910-68348932 AAAGTTAAGGTGAACGGGACAGG + Intronic
1055552804 9:77446619-77446641 AGAGTGAAGGAGAAGGGGTGGGG + Intronic
1056934540 9:90905951-90905973 CAAGTTAAGGGGATGGGATCTGG - Intergenic
1058850995 9:109012715-109012737 CAGGTTCAGGGGAAGGGGTAGGG + Intronic
1060248390 9:121965788-121965810 CAATTTAAGGGGCAGGGTTCTGG + Intronic
1060686022 9:125613462-125613484 CAAGTTAGGGTAAGGGGGTCAGG - Intronic
1060744655 9:126123313-126123335 GAGGTTAAGGAGATGTGGTCTGG + Intergenic
1062121723 9:134837406-134837428 CAGATTAGGGAGCAGGGGTCTGG - Intronic
1185440776 X:226603-226625 CAAGGGAAGGAGCGGGGGTCTGG - Intergenic
1186846292 X:13534204-13534226 CAAGTGAGGGAGAAGGGGAAGGG + Intergenic
1187100110 X:16183457-16183479 AGAGTGAAGGAGAAGGGGTTGGG + Intergenic
1187572400 X:20518479-20518501 CAAGTTTAGGAGAAGCGTTGAGG - Intergenic
1187997671 X:24946199-24946221 CAAGGTAAGTAGAAGAGGACAGG - Intronic
1188644372 X:32546356-32546378 CAAGCAAAGGAGCAGGGATCTGG + Intronic
1192419248 X:71014295-71014317 AAAGTTAAGGAGGAGGAGTTAGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1198551780 X:137752642-137752664 GAAGATAAGGAGAGAGGGTCAGG - Intergenic
1199523883 X:148769763-148769785 CAAGTTAAGGAGAAGGGGTCTGG - Intronic