ID: 1199525104

View in Genome Browser
Species Human (GRCh38)
Location X:148783464-148783486
Sequence CTAAAATACAAGTCAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 407}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199525104_1199525107 -5 Left 1199525104 X:148783464-148783486 CCTTTTCCTGACTTGTATTTTAG 0: 1
1: 0
2: 3
3: 34
4: 407
Right 1199525107 X:148783482-148783504 TTTAGTTAGTTTTTACAGGTTGG 0: 1
1: 0
2: 4
3: 39
4: 493
1199525104_1199525110 22 Left 1199525104 X:148783464-148783486 CCTTTTCCTGACTTGTATTTTAG 0: 1
1: 0
2: 3
3: 34
4: 407
Right 1199525110 X:148783509-148783531 ATAAGCGGAGATTGTCTTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 84
1199525104_1199525109 7 Left 1199525104 X:148783464-148783486 CCTTTTCCTGACTTGTATTTTAG 0: 1
1: 0
2: 3
3: 34
4: 407
Right 1199525109 X:148783494-148783516 TTACAGGTTGGGAAAATAAGCGG 0: 1
1: 0
2: 1
3: 27
4: 253
1199525104_1199525111 23 Left 1199525104 X:148783464-148783486 CCTTTTCCTGACTTGTATTTTAG 0: 1
1: 0
2: 3
3: 34
4: 407
Right 1199525111 X:148783510-148783532 TAAGCGGAGATTGTCTTTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 80
1199525104_1199525108 -4 Left 1199525104 X:148783464-148783486 CCTTTTCCTGACTTGTATTTTAG 0: 1
1: 0
2: 3
3: 34
4: 407
Right 1199525108 X:148783483-148783505 TTAGTTAGTTTTTACAGGTTGGG 0: 1
1: 0
2: 3
3: 45
4: 451
1199525104_1199525106 -9 Left 1199525104 X:148783464-148783486 CCTTTTCCTGACTTGTATTTTAG 0: 1
1: 0
2: 3
3: 34
4: 407
Right 1199525106 X:148783478-148783500 GTATTTTAGTTAGTTTTTACAGG 0: 1
1: 0
2: 1
3: 32
4: 364
1199525104_1199525112 24 Left 1199525104 X:148783464-148783486 CCTTTTCCTGACTTGTATTTTAG 0: 1
1: 0
2: 3
3: 34
4: 407
Right 1199525112 X:148783511-148783533 AAGCGGAGATTGTCTTTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199525104 Original CRISPR CTAAAATACAAGTCAGGAAA AGG (reversed) Intronic
903379946 1:22889715-22889737 CTGCAAGACAAGTGAGGAAAGGG + Intronic
903815779 1:26063444-26063466 CAAAAAGACAAGCCTGGAAAGGG - Intronic
904972928 1:34433217-34433239 CTAAGAGACAAGTGAGGAAGGGG + Intergenic
905859624 1:41341656-41341678 ATACAATATAGGTCAGGAAAAGG + Intergenic
906858954 1:49338465-49338487 TTAAAATACAAGTAAGTGAAAGG - Intronic
907494092 1:54830808-54830830 CTAAACTCCAAATCAGTAAATGG - Intronic
907974970 1:59422790-59422812 CTAAAAGGAAAGACAGGAAAAGG + Intronic
908649360 1:66314805-66314827 CTGAATTACAAGCCAGGCAACGG - Intronic
908736754 1:67284604-67284626 CAGAAAGACAAGTCAAGAAATGG - Intergenic
908855022 1:68417201-68417223 CTAAAATAAAAGTTAAAAAATGG + Intergenic
909421708 1:75474134-75474156 CTAAGATTCAAGGCAGGAGATGG + Intronic
909437258 1:75656782-75656804 CTAAAATACAAGTAACAAAATGG + Intergenic
909617451 1:77627225-77627247 CTTAATTACGAGTTAGGAAATGG + Intronic
909815693 1:79990734-79990756 CTAAAACACAACTTAAGAAATGG + Intergenic
909840398 1:80313887-80313909 CCAAAACACAATTCAGCAAAAGG + Intergenic
909901929 1:81148597-81148619 AGAGAATACAAGGCAGGAAAGGG - Intergenic
910105617 1:83628418-83628440 CTAAAGAGAAAGTCAGGAAAGGG - Intergenic
910135711 1:83966639-83966661 TTAGAATAGAAGTAAGGAAATGG + Intronic
910242004 1:85097070-85097092 TTTAAAAACAAGTCAGGATAAGG - Intronic
910956429 1:92711134-92711156 TGAAAATACAAGGGAGGAAAGGG + Intronic
912033976 1:105287408-105287430 CTAAAATACAAGGCAGAGGAAGG + Intergenic
914888908 1:151605575-151605597 CTAGAATACAAGTCTAGGAAAGG - Intergenic
915311861 1:155009066-155009088 CTGAAAAACAGGTCAGGAAGAGG + Intronic
916200712 1:162268767-162268789 CTAAAAAAGAAGTCAGTAGAAGG + Intronic
917050917 1:170922120-170922142 CTAGAATACAAGTAACAAAATGG + Intergenic
917240330 1:172941179-172941201 AAAAAATAAAAGTCAGGGAAGGG + Intergenic
917853527 1:179084207-179084229 ATAAAATACAGCTGAGGAAACGG - Intronic
919556244 1:199057575-199057597 CTAAAAGTCAGGTCTGGAAATGG + Intergenic
920269228 1:204750895-204750917 CTCAAATAACAGGCAGGAAAGGG - Intergenic
921465951 1:215487958-215487980 AGAAAATTCAAGTCAGAAAATGG + Intergenic
922076724 1:222252741-222252763 ATAAAATGCAAAGCAGGAAATGG + Intergenic
922310553 1:224385321-224385343 ATAAAATAAAAGTCAACAAAGGG + Exonic
923801445 1:237213476-237213498 CTAAAATACAAAACAAAAAAAGG - Intronic
1063269947 10:4497147-4497169 CTAAAATAAAAGTTAAAAAATGG - Intergenic
1064814473 10:19242957-19242979 CTAAAAAACAACTAATGAAATGG - Intronic
1065549013 10:26851835-26851857 CCAAAAGACAAGAAAGGAAAGGG + Intronic
1065901001 10:30207861-30207883 CCAAAATCAAAGTTAGGAAAGGG + Intergenic
1066086938 10:31980329-31980351 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
1066506305 10:36048432-36048454 CTAAAAAAAAAGTGAGGAGAAGG + Intergenic
1066515172 10:36150993-36151015 CTAAAATATAAGACAGTAATAGG + Intergenic
1067514835 10:46930007-46930029 CTAGAAAACATGCCAGGAAAGGG + Intronic
1067647420 10:48121807-48121829 CTAGAAAACATGCCAGGAAAGGG - Intergenic
1068307772 10:55235943-55235965 CTAACATTCCAGTCAGAAAATGG - Intronic
1068794512 10:61063958-61063980 CAAAACTACAAGTAAGGAATGGG - Intergenic
1068799487 10:61123471-61123493 TTAAAATACAAAACAGAAAAGGG - Intergenic
1068990297 10:63143232-63143254 CAAAAATAGAAGTGGGGAAAAGG + Intronic
1069400407 10:68038836-68038858 GTAAAACAAAACTCAGGAAAGGG - Intronic
1070091205 10:73287204-73287226 CTATAATAAAAGTGATGAAATGG + Intronic
1070557651 10:77541098-77541120 CTTTAATATAAGACAGGAAAGGG + Intronic
1071048788 10:81419643-81419665 TTAAATTAAAAGTCATGAAAAGG + Intergenic
1071545261 10:86524037-86524059 CTATCTTACAAGTAAGGAAATGG + Intergenic
1071877510 10:89857459-89857481 ATAAAGTAGAAGTCAGGATAAGG + Intergenic
1072076626 10:91981444-91981466 CTAAAAAAAAAGTCATGCAAAGG - Intronic
1072261988 10:93686363-93686385 ATAAAAGACTAGTTAGGAAAGGG - Intronic
1072561248 10:96577051-96577073 CTATAAAACAAGTTTGGAAAAGG - Intronic
1074670607 10:115786227-115786249 CTAAAAAAAAAGTCTGCAAATGG - Intronic
1077943905 11:6873988-6874010 CCAAAGTACAAGCCAGGAACTGG - Intergenic
1077962238 11:7088072-7088094 ATAAAAAACAAGTTAGAAAAGGG + Intergenic
1078749950 11:14152044-14152066 CCATAATACAAGGCAGGAACTGG - Intronic
1079700572 11:23541205-23541227 CTAGAATAGAATTCAGTAAAAGG - Intergenic
1080045145 11:27800334-27800356 CTAAAAGACAAGTTAAGGAAAGG + Intergenic
1080072598 11:28108018-28108040 CAATAATACAAGTCACCAAAAGG + Intronic
1083073813 11:60016305-60016327 TCTAAATTCAAGTCAGGAAAAGG + Intergenic
1087672344 11:101122690-101122712 ATAAGATACCACTCAGGAAATGG - Intronic
1089241792 11:117087529-117087551 ATATAGTACAAGTCAGGAGAAGG - Intronic
1089530843 11:119128170-119128192 CTAAAACATAAGTCAGACAAAGG - Intronic
1089884266 11:121804175-121804197 TTAAAACACAAGTGAGGAATTGG + Intergenic
1090431930 11:126653470-126653492 ATGAAATTCAAATCAGGAAATGG + Intronic
1093022806 12:14218915-14218937 CTAGTATACAAGTCAGTAAATGG - Intergenic
1093286823 12:17274167-17274189 GAAAAATAAAAATCAGGAAAAGG + Intergenic
1093326028 12:17775042-17775064 CTAAAATAAAAGTTATAAAAAGG - Intergenic
1094399667 12:30048516-30048538 CAAAAATACATGAAAGGAAAAGG + Intergenic
1094693716 12:32795722-32795744 CTAAGATGGAAGTGAGGAAAAGG + Intronic
1095139231 12:38641361-38641383 CTAAAATACAAATTAGGCTAAGG + Intergenic
1095474646 12:42573523-42573545 CTAAGATAAAAGAAAGGAAAAGG + Intronic
1097378450 12:58865803-58865825 AAAAAATTCAAGTCAAGAAAAGG + Intergenic
1098725998 12:73968094-73968116 CTGGCATACAAGGCAGGAAAGGG - Intergenic
1098987084 12:77024254-77024276 CTAACACACAGGTCAAGAAAGGG - Intronic
1099209963 12:79772288-79772310 CCAAAATCAAAGTCAAGAAATGG + Intergenic
1099884709 12:88513387-88513409 ATAAAAAACAAGTAAGGAAATGG + Intronic
1099991679 12:89729030-89729052 CTAAAATAAAAGTTAAAAAAAGG + Intergenic
1100010355 12:89945708-89945730 ATAATAGACAACTCAGGAAAAGG + Intergenic
1100365955 12:93920820-93920842 ATCAGATAAAAGTCAGGAAAAGG + Intergenic
1100454484 12:94739225-94739247 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
1101134121 12:101722113-101722135 CTTAAACACAAGTTAGGAAGTGG + Intronic
1102514948 12:113440115-113440137 CTAAAAAACAAAGAAGGAAAAGG - Intergenic
1104723278 12:131058519-131058541 CTAAAGTACATTTCTGGAAATGG - Intronic
1107386531 13:39915868-39915890 GAAAAAAACAAGCCAGGAAATGG + Intergenic
1108282299 13:48872118-48872140 CTAAAAAAGGAGTCAGCAAAGGG + Intergenic
1109445571 13:62435473-62435495 CTAAAATACAAGCCACAAAATGG - Intergenic
1109610910 13:64763359-64763381 CTGAGATGCAAGTCAGGAATTGG - Intergenic
1110268840 13:73570553-73570575 CGATAATACAAGTTAGAAAATGG + Intergenic
1110309375 13:74030147-74030169 CTAAAATAAAAGTCATGGATAGG + Intronic
1110528264 13:76565281-76565303 CTAAATTTCAAGAGAGGAAAGGG + Intergenic
1110657893 13:78022284-78022306 AAAACATAGAAGTCAGGAAATGG + Intergenic
1110797699 13:79659063-79659085 CTTAAGTACAAGACAGGGAAAGG - Intergenic
1111326484 13:86703420-86703442 CTAAAATAAAAGTTAAAAAAAGG + Intergenic
1112615290 13:100998194-100998216 CAAAAATACTAGGCAGGATATGG + Intergenic
1113169190 13:107480065-107480087 CTAAAATACTAATCAGTAGAGGG + Intronic
1113753538 13:112792809-112792831 CCAAAGTACAAATCTGGAAAAGG - Intronic
1114449317 14:22814540-22814562 CTATAATACAAGACAGGCATGGG + Intronic
1114905688 14:27123025-27123047 AGAAAATACAAGTAATGAAAAGG - Intergenic
1115895410 14:38081094-38081116 CTAATTTACAGGTAAGGAAATGG - Intergenic
1116675328 14:47899150-47899172 CTATAATCCAATTCAGGAGAAGG - Intergenic
1117625638 14:57634910-57634932 ATCCAATCCAAGTCAGGAAAGGG + Intronic
1119021063 14:71115670-71115692 CTAAACTACAATACAGAAAATGG + Intergenic
1120144740 14:80967583-80967605 CTAAAATGTAAGTCAGGTCAGGG - Intronic
1120547445 14:85829139-85829161 AAAAAAAAAAAGTCAGGAAACGG - Intergenic
1120676930 14:87431472-87431494 CCAAAATACAAGACTGGAACAGG + Intergenic
1124123541 15:26913351-26913373 CTAAAATACATGTCAGTGGAAGG - Intronic
1124442881 15:29701271-29701293 TTAAAATACCAGCCAGTAAATGG - Exonic
1124814737 15:32978403-32978425 CCAAAATATAAGTCACAAAATGG + Intronic
1124892472 15:33745818-33745840 CTGAAATACAAGTGAGAAAGTGG + Intronic
1125116447 15:36098508-36098530 CTAAAATAAATGTCAGTGAAAGG + Intergenic
1125425353 15:39543185-39543207 CTAAAATAGAACTTAGGAGATGG + Intergenic
1125969689 15:43901813-43901835 CTAGATTACAGGTCAGGAAAGGG + Intronic
1126062574 15:44797459-44797481 TTAAAAGACAAGACAGAAAAAGG - Intergenic
1126111195 15:45175643-45175665 CTAGAGTAAAAGACAGGAAAAGG + Intronic
1126172495 15:45706007-45706029 ACAAAAAACAAGTAAGGAAAGGG - Intergenic
1127016627 15:54695944-54695966 AATAAATAAAAGTCAGGAAAAGG - Intergenic
1128463963 15:67892853-67892875 TGAAAATGCAAGTCATGAAATGG - Intergenic
1129413665 15:75362955-75362977 CAATTATACAGGTCAGGAAATGG + Intronic
1131174056 15:90199166-90199188 TTAAAACACAAGCCAGGACAGGG - Intronic
1131442368 15:92468554-92468576 CTATAATACAAGGCAGAATATGG - Exonic
1134828229 16:17301914-17301936 CTAAAATACATGTCAGGGCTCGG + Intronic
1134861660 16:17565648-17565670 CTATAATAGAAGTCCGAAAAGGG + Intergenic
1137806854 16:51315050-51315072 CAACAATAAATGTCAGGAAAAGG - Intergenic
1137947057 16:52743612-52743634 ATAAAATACAACTGAGGGAAAGG + Intergenic
1141265428 16:82492645-82492667 CAAAAATGCATGACAGGAAAGGG + Intergenic
1143279873 17:5745810-5745832 ATGAAATAAAAGTCTGGAAACGG + Intergenic
1144529012 17:16018055-16018077 AGAAAAAACAAGTGAGGAAAAGG - Intronic
1145839897 17:27985441-27985463 CATAATTACAAGACAGGAAATGG + Intergenic
1146620403 17:34392840-34392862 ATAAAATATAAGAAAGGAAAGGG + Intergenic
1147814923 17:43202337-43202359 CTGAACTGCTAGTCAGGAAAGGG - Intronic
1148405280 17:47408324-47408346 CTAAATTTAAAGGCAGGAAATGG - Intronic
1148435757 17:47683449-47683471 CCACAATACAAGTCAGGAGAGGG - Exonic
1148522963 17:48299750-48299772 GTAAAATGCAAGACAGGAAGGGG + Intronic
1148884784 17:50764369-50764391 GGAAAAGGCAAGTCAGGAAAAGG + Intergenic
1149568780 17:57657564-57657586 GTAAAATGCAAGTCAGGGGATGG + Intronic
1156335844 18:36170690-36170712 GTAAAATACAGGTTAGGAATGGG + Intronic
1156608588 18:38698769-38698791 CCAGGCTACAAGTCAGGAAAGGG - Intergenic
1156947434 18:42851857-42851879 ATAAAATAAAAGACAGGTAAGGG + Intronic
1156952541 18:42920031-42920053 GAAAAATAAAAGTAAGGAAATGG - Intronic
1157140113 18:45097015-45097037 CCAGAATACAAGTTAGAAAAGGG - Intergenic
1158914585 18:62109943-62109965 CAAAACTACAAGGCAGGAGATGG + Exonic
1159363530 18:67436203-67436225 CTAACATACAATACAGAAAATGG + Intergenic
1159395651 18:67852791-67852813 CTAAAATAAAAGTTAAAAAAGGG - Intergenic
1159792048 18:72793678-72793700 GTAAAATACAAGTGTGGTAAGGG - Intronic
1159849703 18:73513457-73513479 CAAAAATATAAGTAAAGAAATGG + Intergenic
1161458042 19:4379817-4379839 CCAAAATACAAGTAAGCACAAGG - Intronic
1166963402 19:46513551-46513573 CTAACATACAAGCCAGGCTAAGG + Intronic
1167901704 19:52627203-52627225 CTGAAAAAGAAGTCAGCAAAAGG - Intronic
1168569778 19:57456884-57456906 CTAAAATATTAGTGTGGAAAAGG - Exonic
926350583 2:11990389-11990411 CTAAAATACAAAATTGGAAAAGG - Intergenic
926865418 2:17351886-17351908 GTAAAATTGAAGTGAGGAAAAGG + Intergenic
927407318 2:22785964-22785986 TCAAAATACAAGTAAGTAAATGG + Intergenic
927592954 2:24372577-24372599 AAAAAATCCAAGTCAGGAATAGG - Intergenic
928432233 2:31229801-31229823 ATAAAACACTAGTCAGGAATGGG - Intronic
928869483 2:35959947-35959969 CTGAAAGACAGGTCAGGAAATGG - Intergenic
928993284 2:37258534-37258556 CTAAAATAGAGGTCAGAAAGTGG + Intronic
929829618 2:45336327-45336349 CTAACATCCAAGTCAGGACTGGG - Intergenic
930347415 2:50201902-50201924 TTTAAATACAGGTAAGGAAAAGG - Intronic
930448715 2:51507248-51507270 CAAAGATACAAGTCAGAAAGGGG - Intergenic
930698750 2:54438505-54438527 GTAACAAACAAGTCAGGCAAAGG - Intergenic
931090233 2:58877815-58877837 CTATTTTACCAGTCAGGAAATGG + Intergenic
931092112 2:58897316-58897338 TTAAAATACAACACATGAAAAGG + Intergenic
931456241 2:62411724-62411746 CTAAAATACCAGGGAGGAAAAGG + Intergenic
931629979 2:64289974-64289996 CTGAAAGTCAAGTCAGGATATGG - Intergenic
932282746 2:70508643-70508665 CTAAAACAAGAGTCATGAAATGG + Intronic
933124028 2:78581208-78581230 TAAAAATACAAGTAAGAAAAAGG - Intergenic
933757216 2:85649229-85649251 TAAAAATACAAATCAGGAAATGG - Exonic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935690667 2:105728505-105728527 CTGAACTACAAGACAGGAACAGG + Intergenic
936855902 2:116957108-116957130 CAAAGATACAACTCAGGAATGGG + Intergenic
936875084 2:117179346-117179368 ATAAAATACCACCCAGGAAAAGG + Intergenic
937702676 2:124881720-124881742 AAGAAATACAAGTCAGGCAATGG - Intronic
938566042 2:132520074-132520096 ATAAATTATAAGTCAGAAAAAGG - Intronic
938662395 2:133500882-133500904 CTTAAATACAACACAGGGAAGGG + Intronic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
940149481 2:150583719-150583741 CTAAAATAAAAGTTAAAAAAAGG + Intergenic
940897245 2:159092668-159092690 CAAAAATAAAAGTCCAGAAAGGG - Intronic
941042605 2:160640067-160640089 TTCAAATACAAGGCAGGAAGAGG - Intergenic
941405950 2:165088589-165088611 CTAAAATAAAAGTTAGATAATGG - Exonic
942073773 2:172338463-172338485 CTAAAATAAAGGTAAGGCAAGGG + Intergenic
942109356 2:172664884-172664906 CTATAACAAAAGCCAGGAAATGG - Intergenic
942365761 2:175225184-175225206 ATAACAAACAACTCAGGAAAGGG - Intergenic
942953377 2:181747533-181747555 TTAAAATACAAGTCACAAACTGG - Intergenic
943828410 2:192426184-192426206 CTCCAATGCAAGTCAGAAAATGG - Intergenic
945405154 2:209437839-209437861 CTCAAATACAAGTCCTGATAAGG - Intronic
945675128 2:212846679-212846701 CTGAAATAAAAGTCAAAAAATGG + Intergenic
945682763 2:212933999-212934021 CTGAAAAAAATGTCAGGAAATGG + Intergenic
945759329 2:213893858-213893880 CTAAAAAACAAGCAACGAAATGG + Intronic
945816538 2:214611666-214611688 CCAAAACAGAGGTCAGGAAATGG - Intergenic
947003597 2:225486163-225486185 CTAAAATAATAGCCAGGAGAAGG - Intronic
947940676 2:234052271-234052293 ATACAATACAAGCAAGGAAAGGG - Intronic
948164068 2:235847849-235847871 GTAAAACACAAGCCAGGAACAGG - Intronic
949069734 2:242017243-242017265 CCAAAATACAAGTCAGAACAGGG + Intergenic
1170184361 20:13571661-13571683 GTAAAATACAAGTCAGGTAATGG + Intronic
1170273675 20:14557427-14557449 GTAAAATACAGGTCACAAAATGG + Intronic
1170576498 20:17665932-17665954 GGAAAAGACCAGTCAGGAAATGG - Intronic
1170611879 20:17921092-17921114 CTAAAATACAAAACAGAATAGGG + Intergenic
1171121769 20:22575053-22575075 CTAAAGTACCACTCATGAAAAGG - Intergenic
1172943864 20:38673449-38673471 CTAAAATCCAAGCCTGGAAGTGG - Intergenic
1175651028 20:60723287-60723309 CAAAGATACAGGTCAGGATATGG + Intergenic
1176211536 20:63925483-63925505 CAAAAATAAAAATTAGGAAAGGG + Intronic
1177299903 21:19229785-19229807 ATCACATACAAGTCAGAAAAAGG + Intergenic
1177378152 21:20300769-20300791 CTCAAATGAAAGTCAAGAAAAGG - Intergenic
1177627720 21:23685443-23685465 CAAAAGTTAAAGTCAGGAAATGG - Intergenic
1182039867 22:27229322-27229344 ACAAAATACAAGTCAGAAAGAGG - Intergenic
1183965979 22:41443123-41443145 TTAAAACACAAGTCAGCACAAGG - Intronic
1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG + Exonic
949553793 3:5134810-5134832 CCATAAAACAAGTTAGGAAATGG + Intronic
949896537 3:8771059-8771081 ATAAAACAAAAGACAGGAAATGG - Intronic
950112475 3:10428403-10428425 ATGAAATACAAGGCAGGAGAGGG - Intronic
951426441 3:22551814-22551836 ATAAAGTACAAGTGAGGACATGG + Intergenic
952592405 3:34972807-34972829 TTAAAATACAAATGTGGAAAGGG + Intergenic
952661529 3:35856026-35856048 CTAAAATACAACACTGAAAAAGG - Intergenic
955013312 3:55041850-55041872 TTAAACTACAAGACAGTAAAAGG - Intronic
955058463 3:55475981-55476003 CTGAAATACATGCAAGGAAAGGG + Intronic
955377153 3:58407487-58407509 GTAAAAGACAACTCAAGAAATGG - Intronic
955559470 3:60173230-60173252 CTAAGATACCAGTCTGGGAATGG - Intronic
955872503 3:63454184-63454206 GAAAAATACAAATCAGGTAAAGG + Intronic
956027996 3:65004349-65004371 ATAAAAAATAACTCAGGAAAAGG - Intergenic
956958161 3:74365496-74365518 CTAAACACCAAGTGAGGAAAGGG + Intronic
957547300 3:81656219-81656241 TTAAAGTACAAATCTGGAAATGG + Intronic
957939407 3:86986751-86986773 CTAAAATAAAATACAGGAAGTGG - Intronic
957961490 3:87259555-87259577 CTAATATACATGTTTGGAAAAGG + Intronic
958537858 3:95426882-95426904 TTAAAATACGAAACAGGAAATGG + Intergenic
959050138 3:101516795-101516817 CTAAAATAAAAGTCAAAAAAGGG + Intergenic
959602045 3:108198257-108198279 TTAAAATACAAGTGATGAACTGG - Intronic
959642219 3:108654528-108654550 CTATAATTAAAGCCAGGAAATGG - Intronic
960557380 3:119044152-119044174 CTAAAAAACAACACAGGATATGG + Intronic
960578399 3:119250312-119250334 CTAATATCAAAATCAGGAAAGGG + Intergenic
960591577 3:119371648-119371670 CTAAAATAAAAGTTAATAAAAGG - Intronic
961343755 3:126247660-126247682 CTGAAAAAGAAGTCAGCAAAGGG - Intergenic
961981687 3:131085911-131085933 ATAAAAAACAAGGCAGGAAAGGG - Intronic
962616612 3:137132969-137132991 CAATAATATAAATCAGGAAAAGG - Intergenic
963399542 3:144780198-144780220 CCAAAACACAAGTCTGCAAATGG + Intergenic
963617137 3:147555521-147555543 CTAATATAGAAGCCAGGATAAGG - Intergenic
965258020 3:166442274-166442296 CTAAAATAAGAGACAGCAAAGGG - Intergenic
965392168 3:168118367-168118389 CTAAAATAAAAGTTAAAAAATGG - Intergenic
966635341 3:182127113-182127135 TTAAAATACAACTCTGGATATGG + Intergenic
966794871 3:183703803-183703825 TCAAAATAGAATTCAGGAAATGG + Intronic
967272702 3:187744131-187744153 ATAAAATAAAATTTAGGAAAGGG + Intronic
967330315 3:188283525-188283547 CTGAACTGCAAGTCAGAAAAAGG - Intronic
967682045 3:192375533-192375555 CTAAAATACTAGCCAGTAATAGG - Intronic
967798565 3:193627850-193627872 CTAATTTACAAATCGGGAAAGGG - Intronic
968106951 3:196007982-196008004 CCAAAATACAAGTCAGAACAGGG - Intergenic
968840059 4:2996863-2996885 TTAAAATAAAAGACAAGAAAAGG - Intronic
969331564 4:6476217-6476239 CTAACCACCAAGTCAGGAAAGGG + Intronic
969395282 4:6916586-6916608 CTTCAATACAAGTCAGAAAGCGG - Intronic
970311049 4:14782976-14782998 CTAACATGTAAGTTAGGAAAAGG + Intergenic
970466386 4:16327334-16327356 TAAAAATACAAGTCAGTACAAGG + Intergenic
970688455 4:18594654-18594676 CTAAAATACTAGTGAGCAAGTGG - Intergenic
971149075 4:24011968-24011990 CTAAAATGCAACCCAGCAAAAGG + Intergenic
971438027 4:26649035-26649057 CAAACATAAAAGACAGGAAAAGG - Intronic
971617936 4:28817449-28817471 CAAAAACACACGTTAGGAAAAGG + Intergenic
971760710 4:30761063-30761085 CTAGAATACAATACAAGAAAGGG - Intronic
972116408 4:35640305-35640327 TTTAAATACAAGTCATGAAAAGG + Intergenic
972165263 4:36276179-36276201 CAGACATACGAGTCAGGAAATGG - Intergenic
972977100 4:44649358-44649380 CAAGAATACATGTCAGGAAATGG - Intronic
975757059 4:77581310-77581332 CTAAAATACAAGTTACCAAGTGG + Intronic
977035816 4:91951737-91951759 ATAAAATAGGAATCAGGAAAGGG + Intergenic
977427153 4:96881803-96881825 CTAAAATACAAGTTGGTAAAGGG + Intergenic
977439587 4:97046929-97046951 CTAACATCCAATTCAAGAAATGG + Intergenic
978337495 4:107685403-107685425 CTAAAATTAAAGTAAGTAAAAGG + Intronic
978821685 4:112973938-112973960 CTAAAAAGCAAGTCATTAAAAGG + Intronic
978859595 4:113432328-113432350 CTAAAATATCAGACAGCAAAAGG + Intergenic
979077023 4:116284553-116284575 CTAAAATGCATTTCTGGAAAGGG + Intergenic
979078542 4:116304790-116304812 CTTAACTACAACTCAGAAAAAGG - Intergenic
979164184 4:117505692-117505714 TTAAAATACAAGTCAAAAAATGG + Intergenic
979968161 4:127101994-127102016 CTAAACTTCAAGGCAGGAATTGG - Intergenic
980002191 4:127502890-127502912 CTATTATACAAGCAAGGAAAGGG - Intergenic
980263357 4:130482841-130482863 CTAATATCCAAACCAGGAAAAGG + Intergenic
980824661 4:138059170-138059192 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
982175086 4:152698458-152698480 ATAGAATACAAGTTAGGGAATGG - Intronic
983008176 4:162511509-162511531 CACTAATAAAAGTCAGGAAAAGG + Intergenic
983114747 4:163800262-163800284 CTAAAATAAAAATCAGAAAAAGG + Intronic
983793105 4:171823300-171823322 GTAAGATACAAGTCAGGAGAAGG + Intronic
984482092 4:180318477-180318499 TGAAAATTCAAGACAGGAAAGGG + Intergenic
984498615 4:180531009-180531031 TAAAAAACCAAGTCAGGAAAGGG - Intergenic
984981967 4:185290899-185290921 AAAAAAGACAAATCAGGAAAGGG + Intronic
985831587 5:2237721-2237743 CTAAAATAAAAGTTACGAAAAGG + Intergenic
986235033 5:5901614-5901636 ATACTATATAAGTCAGGAAAAGG + Intergenic
987099045 5:14576668-14576690 CTAATATATAAGTAAGGACATGG + Intergenic
987546178 5:19313150-19313172 ATAAAATACAATAAAGGAAAGGG - Intergenic
988066365 5:26231619-26231641 CTGAAATACAAGTCAGAACGGGG - Intergenic
988501757 5:31789596-31789618 CCAAAATACAATACTGGAAAAGG + Intronic
988601086 5:32640053-32640075 TTAAAAAACAAGTCTGGACATGG - Intergenic
989023131 5:37033950-37033972 TGAAAATACAAGTCACAAAATGG + Intronic
989065374 5:37455535-37455557 CCAAAAAACAAATCAGGATAAGG - Intronic
989133723 5:38132420-38132442 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
989783969 5:45304797-45304819 AAAACAAACAAGTCAGGAAAAGG - Intronic
991765441 5:69972700-69972722 CAAAAATACAAGTTACGCAAAGG - Intergenic
991844677 5:70847772-70847794 CAAAAATACAAGTTACGCAAAGG - Intergenic
992961461 5:81960102-81960124 ATAAAATAAAAGTGAGGAGAGGG - Intergenic
993017965 5:82557875-82557897 CTGAAATACAGGGAAGGAAATGG - Intergenic
993135839 5:83962643-83962665 TTAAAATACAATGAAGGAAACGG + Intronic
994084199 5:95740720-95740742 CTAGAATACAAGTCAGATCATGG + Intronic
994154575 5:96488662-96488684 CAAAAATCCAAGAAAGGAAACGG - Intergenic
994520603 5:100829450-100829472 CTAAAATAGAATTCAGGCAAAGG - Intronic
995132544 5:108645823-108645845 TTAAAAAGCAAGTCAGGATAAGG - Intergenic
995648543 5:114341591-114341613 ATAAAAAAAAAGTCAGGATATGG + Intergenic
995769120 5:115651095-115651117 CCAAAAAAGAAGTCAGCAAAGGG - Intergenic
996110532 5:119561242-119561264 CAAAAATATAAGTTAGGGAAAGG + Intronic
996399991 5:123052038-123052060 CCAAAATACAAGTAACAAAATGG - Intergenic
996643179 5:125782706-125782728 GTAAAATACATGTCAGATAAAGG - Intergenic
997427211 5:133811550-133811572 CTCAAACACAAATCAGCAAAAGG + Intergenic
998714081 5:144862205-144862227 TAAAAATAGAAGTAAGGAAAAGG - Intergenic
999220180 5:149969628-149969650 CTAACTTCCAAGGCAGGAAAGGG - Intronic
999228204 5:150045105-150045127 CTAAAAAACAAGTCTGGGGATGG - Intronic
1000646229 5:163763673-163763695 CTAAAATATAAATGAGGGAAGGG + Intergenic
1000950990 5:167483087-167483109 CTATGTTACAAGTGAGGAAAAGG - Intronic
1000957142 5:167556828-167556850 CTAAAATACAAGTGAGACCAAGG - Intronic
1001971095 5:175955556-175955578 CTGGAATACAGGTCAGGGAATGG - Intronic
1002246348 5:177888221-177888243 CTGGAATACAGGTCAGGGAATGG + Intergenic
1003475350 6:6476912-6476934 CTAAAATCCAAGACAGGCCATGG + Intergenic
1003654351 6:7992036-7992058 TTAAAATATAAGACAGTAAATGG + Intronic
1003916648 6:10792941-10792963 CTAAAATACAATTCAACAGAAGG - Intronic
1004036588 6:11930335-11930357 CCAAAAAACAAGACAGGAAGGGG + Intergenic
1004104737 6:12655697-12655719 ATAAAATAGAAGTCAGGATGTGG + Intergenic
1004767680 6:18748987-18749009 CGAACATACAAGTCAAGACACGG - Intergenic
1005047160 6:21653388-21653410 CTAAAAAAGCAGACAGGAAAAGG + Intergenic
1005499837 6:26420291-26420313 CAATAATACAAGACAGGATATGG + Intergenic
1005786843 6:29252456-29252478 CCAAAACAGAAGTCAGCAAAGGG + Intergenic
1007149468 6:39674146-39674168 CTAAAATATATGTCAGTAAAGGG - Intronic
1008332196 6:50258955-50258977 CAAAAATAGAATTCAGAAAATGG - Intergenic
1009284413 6:61797862-61797884 CTAAAATAAAAGTTGAGAAAAGG - Intronic
1009355167 6:62734915-62734937 CTAAATTAAAAGTCAAAAAAAGG + Intergenic
1009897277 6:69768302-69768324 CTATAAAATAAGTCAGGAATTGG - Intronic
1009915534 6:69990888-69990910 CTAAAATAGAAGTCAGAAAAAGG - Intronic
1010144404 6:72650139-72650161 ATAAGAAACAAGACAGGAAAAGG - Intronic
1010787803 6:80025087-80025109 CTAAAGTAAAATTAAGGAAATGG - Intronic
1012035293 6:94129563-94129585 ATAAGTAACAAGTCAGGAAAAGG + Intergenic
1012286246 6:97392471-97392493 ATAAAATATAATTAAGGAAATGG + Intergenic
1012738604 6:102982933-102982955 CTTAAATCCAAGTGAAGAAAAGG + Intergenic
1012738687 6:102984588-102984610 TTAAAATTCAAGTAAGCAAAAGG + Intergenic
1013322463 6:109008756-109008778 CTAAAGGACAATTCAGAAAAGGG + Intronic
1013356860 6:109353092-109353114 CTAAATTACAAGTCAATAAATGG + Intergenic
1013360311 6:109387738-109387760 CTAAGGAACAAGTCAGGAAAAGG - Intergenic
1013599430 6:111690540-111690562 CTCAAACACTATTCAGGAAAGGG - Intronic
1013699460 6:112747079-112747101 TTTACATAGAAGTCAGGAAAAGG + Intergenic
1013730749 6:113163533-113163555 ATAAAATACAAAGCAGGACACGG - Intergenic
1013899099 6:115131788-115131810 GTAAAATACAAATTAGGGAAGGG - Intergenic
1013960812 6:115897810-115897832 TTAAAATAAAACTCAGTAAAAGG - Intergenic
1014342034 6:120222530-120222552 ATGCAATACAAATCAGGAAAGGG + Intergenic
1014627585 6:123747412-123747434 TTAAAATACCATTAAGGAAAGGG + Intergenic
1014866324 6:126534783-126534805 CTACTTTACAAATCAGGAAATGG + Intergenic
1014956623 6:127626455-127626477 CTAAAATAAAACTAAGAAAACGG - Intergenic
1015441864 6:133257796-133257818 CTAAAGCACATGTCAGGAAATGG - Intronic
1016339162 6:143042723-143042745 CTAGGATATAATTCAGGAAAGGG + Intergenic
1016445646 6:144129417-144129439 CTAAAATAAAAGTCAAAAAAAGG + Intergenic
1016476986 6:144438374-144438396 TTAAAATAAAAGTCACAAAATGG - Intronic
1016772445 6:147867033-147867055 CTAAGATCCAAGCTAGGAAAAGG + Intergenic
1017074130 6:150601557-150601579 CAAAAAGTCAAGTCAGGAATTGG - Intronic
1017983230 6:159420980-159421002 GGAAAATACAATTCTGGAAATGG + Intergenic
1018091756 6:160351672-160351694 CTAAGATACAAATCATGCAAAGG + Intronic
1018126542 6:160688617-160688639 GTAAAATAAAAATCATGAAAAGG + Intergenic
1019054070 6:169208271-169208293 CTAGAAAACAAGTAAGAAAATGG + Intergenic
1019999645 7:4748433-4748455 CAAAAGTACAAGGAAGGAAATGG - Intronic
1024568773 7:50707212-50707234 CCAAAATAAATGTCAGGAAGAGG - Intronic
1026774818 7:73224911-73224933 ACAAAAAACAAATCAGGAAAAGG - Intergenic
1027015672 7:74778282-74778304 ACAAAAAACAAATCAGGAAAAGG - Intronic
1027072355 7:75167655-75167677 ACAAAAAACAAATCAGGAAAAGG + Intergenic
1027379101 7:77586422-77586444 ATAAAATACAAGACAGGACCAGG + Intronic
1027515899 7:79141205-79141227 AGATAATACAAGACAGGAAAAGG - Intronic
1027980342 7:85211353-85211375 CTAAAATACATATCAACAAAAGG - Intergenic
1028313988 7:89376705-89376727 CAAAAACATAAGTCGGGAAAAGG - Intergenic
1028484377 7:91342006-91342028 TTGAAATACAATTCAGTAAATGG + Intergenic
1028825527 7:95268722-95268744 CAACAGTACAAATCAGGAAACGG - Intronic
1029579865 7:101428824-101428846 TGAAAATACAAGCCAGGGAATGG - Intronic
1029898154 7:104008153-104008175 CTAAAATTCAAATATGGAAAAGG - Intergenic
1030209159 7:106979559-106979581 CTAAAATAAAAGGGAGGCAACGG + Intergenic
1030713646 7:112784095-112784117 CTAAAATAAATGTCAAGGAAAGG + Exonic
1031358934 7:120823173-120823195 CTAAAATAAAAGGGAGGCAAAGG + Intronic
1032969327 7:137140642-137140664 CTAAAATAACAGTCAAAAAATGG + Intergenic
1033463265 7:141566773-141566795 TAAAGATACAAGTGAGGAAATGG - Intronic
1034007493 7:147490257-147490279 CTGAAATACTAGTAAGGAACAGG + Intronic
1034206531 7:149320748-149320770 CCAAAATACAAGTCAGGAGAGGG + Intergenic
1034706360 7:153149135-153149157 GAAAAAAACAAGCCAGGAAAAGG + Intergenic
1034733451 7:153408443-153408465 ATCAAATAGAAGGCAGGAAAAGG - Intergenic
1035026061 7:155827050-155827072 GTAAAATGCAAGCCAGGAATCGG + Intergenic
1035099567 7:156385037-156385059 CTAAAATGCAATTCACAAAAGGG - Intergenic
1035754249 8:2019576-2019598 CTAAAACAAGAATCAGGAAAAGG + Intergenic
1036039507 8:5059769-5059791 ATTACATAAAAGTCAGGAAACGG - Intergenic
1038367425 8:26950197-26950219 TTAAAATAAATGTCAGGAAAAGG - Intergenic
1038739032 8:30200222-30200244 GATTAATACAAGTCAGGAAAAGG + Intergenic
1039329123 8:36517192-36517214 ATAAAATACAAGTGAACAAACGG + Intergenic
1039814698 8:41082796-41082818 CCAAATTCCAAGTGAGGAAAAGG + Intergenic
1040690832 8:49936658-49936680 CAAAAAGAAAAGTCAGGAAGTGG - Intronic
1043170465 8:76959524-76959546 ATAAAATAAAAGTAAGTAAAAGG - Intergenic
1043680493 8:83018976-83018998 CTAAGATACAAGACATGAAAAGG - Intergenic
1043860594 8:85311788-85311810 CATAAATACAGGTTAGGAAATGG + Intergenic
1043924424 8:86021036-86021058 AAAGAATACAACTCAGGAAAAGG - Intronic
1044345023 8:91095236-91095258 GGAAAATACAAAGCAGGAAAGGG - Intergenic
1045759849 8:105591871-105591893 ATATAATACCAGTGAGGAAAAGG + Intronic
1046024459 8:108705481-108705503 CTTATATACAAATTAGGAAAAGG + Intronic
1046151924 8:110238649-110238671 CTAAAACACAAATCTGGTAATGG + Intergenic
1046699781 8:117387229-117387251 CAAAAATAAAAGAGAGGAAAAGG + Intergenic
1046703902 8:117428890-117428912 CTAAAATATAAATAAGCAAATGG + Intergenic
1048558080 8:135501352-135501374 ATAAAATACCAGTCATGATATGG + Intronic
1048661129 8:136602601-136602623 ATAAAAAACAATTCAGAAAAGGG + Intergenic
1049172069 8:141167614-141167636 CTTAAAGACAACTCAGGACAGGG - Intronic
1050042202 9:1507795-1507817 ATAGCACACAAGTCAGGAAAGGG - Intergenic
1051158699 9:14181230-14181252 CAAAAAGACAATTAAGGAAATGG - Intronic
1051159777 9:14194094-14194116 CTAAAATACATTTCAGGCACAGG - Intronic
1052139150 9:24956360-24956382 CGAAAATAGAAGACAGGAAAAGG - Intergenic
1055202389 9:73682395-73682417 CTGAAAAACAAGTAAGAAAATGG - Intergenic
1055406190 9:75976138-75976160 CTGAAATACAAGTTAGAAAATGG + Intronic
1055631099 9:78224299-78224321 CCAAAATAAAAGACATGAAAAGG - Intergenic
1055820112 9:80252293-80252315 ATAAAAAACAAGTCAGAGAATGG - Intergenic
1055912423 9:81367925-81367947 CTAAAATAAAAGTTAAAAAATGG + Intergenic
1056332359 9:85531556-85531578 CTAAAAAATAAGTTAGTAAATGG - Intergenic
1057155835 9:92838371-92838393 ATAATGTACAAGGCAGGAAAAGG + Intergenic
1057368758 9:94450455-94450477 CTATATTAAAATTCAGGAAAAGG - Intronic
1057695394 9:97319330-97319352 CTAAAATAAAAGTTAAAAAAAGG - Intronic
1057707468 9:97406512-97406534 ATGAACTACAAGTCAGGAGAGGG + Intergenic
1058565299 9:106277779-106277801 CTAAAACAGAACACAGGAAAAGG + Intergenic
1059890163 9:118793034-118793056 CTATAATACAAGGCAGAAAGAGG - Intergenic
1060873274 9:127059972-127059994 CTAAATTAGAAGCCAAGAAAGGG + Intronic
1061364963 9:130167912-130167934 CTAAAAACCAGGTCAGGAAGAGG + Intergenic
1061663829 9:132148615-132148637 CGAAGGTACAAGTCAGGAACTGG + Intergenic
1186573629 X:10742218-10742240 TTAAAATGCAATTCTGGAAATGG - Intronic
1186922649 X:14299020-14299042 CTAAAAACCAAGAAAGGAAAGGG - Intergenic
1187075903 X:15934500-15934522 CTATATTACAAATGAGGAAATGG - Intergenic
1187179271 X:16928167-16928189 ATAAATTACAAGTGGGGAAAAGG - Intergenic
1187831270 X:23384055-23384077 ATCAGATACAAATCAGGAAAGGG + Intronic
1188311289 X:28619861-28619883 CTAAAATATGACTTAGGAAATGG - Intronic
1188535808 X:31195575-31195597 TTAAAATCCAGTTCAGGAAAAGG + Intronic
1191678383 X:63815543-63815565 CTAAACTACAATTTAGCAAAAGG - Intergenic
1193230410 X:79038267-79038289 CTAAAATAAAAGTTAAAAAATGG - Intergenic
1194547491 X:95256064-95256086 CAAAAATACAATTCAATAAAAGG - Intergenic
1194809411 X:98372507-98372529 CTATTATACCAGTCAGAAAAAGG - Intergenic
1195574574 X:106435611-106435633 CTAAAATAGAATTCAGAGAAAGG + Intergenic
1196356882 X:114805423-114805445 TTAAAATTGAAGTCAGGAAATGG - Intronic
1196621056 X:117824260-117824282 CAAAAATATAAATCAGGGAAAGG - Intergenic
1197220134 X:123904390-123904412 AAAAAATACAAGTAAAGAAACGG - Intronic
1197238551 X:124096276-124096298 ATAGAATACATGTAAGGAAAAGG - Intronic
1197976285 X:132169045-132169067 CTATATTACAAATGAGGAAATGG + Intergenic
1199108995 X:143907978-143908000 TTAAAATACAAGTTAAAAAAAGG + Intergenic
1199428932 X:147736516-147736538 CTAAAATAAAAGTTAAAAAAAGG - Intergenic
1199525059 X:148782957-148782979 CTAAAGTATAAATCAGGAAAAGG + Intronic
1199525104 X:148783464-148783486 CTAAAATACAAGTCAGGAAAAGG - Intronic
1200041274 X:153371747-153371769 ACAAAATACAAGTTAGGATATGG - Intergenic
1201362186 Y:13164582-13164604 CTAAAAAAGGAGTCAGCAAAGGG + Intergenic