ID: 1199528224

View in Genome Browser
Species Human (GRCh38)
Location X:148816561-148816583
Sequence CAGTATTAGAATAATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 376}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199528224 Original CRISPR CAGTATTAGAATAATGAGAA TGG Intronic
900937869 1:5778282-5778304 CTGTATTAGAAGCATGAGAATGG + Intergenic
901693123 1:10987002-10987024 CTCTATTAGAATCATGAGACCGG + Intergenic
903368785 1:22821387-22821409 CAGCATTAGAATAATGCTGATGG - Intronic
909133976 1:71773828-71773850 AGTTATTAGAATAATGATAACGG - Intronic
909452692 1:75816045-75816067 CATTATTTGAATACTTAGAATGG + Intronic
909696199 1:78470676-78470698 CAGTATTTGGATAAAGAGAGTGG + Intronic
910373169 1:86540204-86540226 TAGAATTAGAAAAATGAGTATGG + Intergenic
910378839 1:86603477-86603499 CATTATTAGCAGCATGAGAATGG - Intergenic
911077629 1:93893827-93893849 AAATATTTGATTAATGAGAATGG - Intronic
911482968 1:98467522-98467544 CATTAATAGAAGAATGAGAAAGG + Intergenic
911698580 1:100924012-100924034 CAGAATTAGAATAGTAAGAGTGG - Intronic
911705423 1:101006216-101006238 CTTTATTAGAAGCATGAGAATGG + Intronic
912335123 1:108855018-108855040 CAGTATTCCAATACTGAGACTGG - Intronic
912655847 1:111485813-111485835 CAGTATGCAAATGATGAGAATGG + Exonic
912753313 1:112303460-112303482 AAGTATTAGAAAAATCAGAGTGG + Intergenic
913596525 1:120384294-120384316 AAGTATTACAAAAATGACAAAGG - Intergenic
914090743 1:144494688-144494710 AAGTATTACAAAAATGACAAAGG + Intergenic
914307863 1:146439527-146439549 AAGTATTACAAAAATGACAAAGG - Intergenic
914331518 1:146675045-146675067 CAGTAAGAGAAGAAAGAGAAAGG - Intergenic
914594246 1:149133606-149133628 AAGTATTACAAAAATGACAAAGG + Intergenic
915938151 1:160100939-160100961 CAGTATGAGTATGATGAGAGGGG + Intergenic
918635944 1:186774293-186774315 CAGTATGAAAATAATGTCAAAGG + Intergenic
918655493 1:187020722-187020744 CAGTATTAGAAAGATTATAAAGG + Intergenic
919074274 1:192795053-192795075 CAGAATTAGAAAAGTGAAAATGG + Intergenic
920262833 1:204701193-204701215 CAGGATTAGAATAAGGATCAGGG - Intergenic
920759716 1:208771159-208771181 CATTTTTAGAATTATGAGTAAGG - Intergenic
921536308 1:216352871-216352893 GAGGATCAGGATAATGAGAAAGG + Intronic
921673761 1:217954565-217954587 GAGTATTAAAACAATTAGAATGG + Intergenic
923187135 1:231585277-231585299 CAGTGTATGAATAATGAGAAGGG + Intronic
923346074 1:233053829-233053851 CAAAATAATAATAATGAGAATGG - Intronic
924497595 1:244605148-244605170 CAGAATTACTATGATGAGAACGG - Intronic
924545808 1:245026004-245026026 CAGTATTAGTGGTATGAGAATGG + Intronic
1063491528 10:6468340-6468362 GAGAATGAGAATAAAGAGAATGG + Intronic
1065369257 10:24966527-24966549 CATTAAGAGAATAATGAAAACGG - Intergenic
1066753591 10:38686287-38686309 TCGTATTAGAATAATGTTAAGGG + Intergenic
1067958757 10:50823641-50823663 CAGTATTAGAATCACCTGAAGGG - Intronic
1068357935 10:55935554-55935576 CTATATTAGCCTAATGAGAAAGG + Intergenic
1068761874 10:60721280-60721302 CAGGAAGAGAAAAATGAGAATGG + Intronic
1069336530 10:67358309-67358331 CACTATTACAAAAATGAAAAGGG + Intronic
1070027185 10:72642926-72642948 CAGGATTACAATAATTATAATGG - Intergenic
1071370009 10:84941566-84941588 CAGTAGTAGCGTTATGAGAATGG + Intergenic
1071382627 10:85083431-85083453 GAGAATTAGACTACTGAGAAAGG + Intergenic
1072340410 10:94442625-94442647 CAGTACTAGATAAGTGAGAATGG + Intronic
1072343501 10:94479354-94479376 AAGTATTAACATAATGAAAAGGG + Intronic
1073037781 10:100576202-100576224 CTGTATTAATATAATGTGAATGG - Intergenic
1075298404 10:121298423-121298445 CAGTTTTAGAACAATGCGAGAGG + Intergenic
1076207773 10:128616765-128616787 CTTTATTAGAAGCATGAGAAAGG + Intergenic
1077759265 11:5073436-5073458 AACGATAAGAATAATGAGAAAGG + Intergenic
1078307894 11:10209213-10209235 CTGTATTTGTGTAATGAGAAAGG - Intronic
1078346991 11:10558915-10558937 CAGGGTTACAATAAGGAGAAGGG + Exonic
1079001391 11:16760017-16760039 CAGTGTTTGAATCATGATAAGGG - Intergenic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1079476842 11:20840009-20840031 AAATAATAGATTAATGAGAAAGG + Intronic
1079638281 11:22772952-22772974 CAGTCCTAGAATAAAGAGAGGGG + Intronic
1079917428 11:26387041-26387063 AAGTCTTATAATAATTAGAATGG + Intronic
1080734679 11:35001800-35001822 CAACTTTAGAAGAATGAGAATGG + Intronic
1080837514 11:35953465-35953487 CGGTCTTATAATAATGAGAAGGG - Intronic
1081036116 11:38148683-38148705 CATTCTTAGAATACTGAGAATGG - Intergenic
1082134883 11:48536393-48536415 CAGTACTTGAGGAATGAGAAAGG - Intergenic
1083570735 11:63761164-63761186 CAGTATTAAAAGCTTGAGAACGG - Exonic
1084994053 11:72957780-72957802 CAGAAAAAGAATAATGATAATGG + Intronic
1085008866 11:73121291-73121313 CAGTATTTGAAATATGAGATGGG - Intronic
1086195802 11:84137748-84137770 CATTCTTAGAATCCTGAGAAAGG - Intronic
1086560099 11:88157419-88157441 CAGTATCAGACAAATGAGCAAGG + Intronic
1086802723 11:91196902-91196924 CACTATAAGAAAAGTGAGAAAGG - Intergenic
1086898822 11:92343238-92343260 CAGTATTATTATGATGAAAAAGG + Intergenic
1087551339 11:99654291-99654313 CAGTGTTAGAATTTTGAGATTGG + Intronic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1089358560 11:117871655-117871677 CATTATTAGGATTATTAGAATGG - Intronic
1089440175 11:118508842-118508864 CAGTATTAGAAAAAAATGAAAGG - Intronic
1090114520 11:123954239-123954261 CAGTGGTAGTTTAATGAGAATGG - Intergenic
1091536791 12:1417980-1418002 CAGCAGTAAAATAATGAAAATGG - Intronic
1091543082 12:1480479-1480501 CAGTATTAGAAAATGGAGAATGG + Intronic
1092589830 12:9942710-9942732 ATGTATTAGAAAAATAAGAAAGG + Intergenic
1092807789 12:12242184-12242206 GAGTGTTAAAATAATTAGAAGGG - Intronic
1093361406 12:18233670-18233692 CTTTATTAGAAGTATGAGAATGG + Intronic
1093829504 12:23738217-23738239 AAGTATTAGAATACATAGAATGG + Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1094610221 12:31988601-31988623 CTGTATTTTAATAATGAGACCGG + Intronic
1095611108 12:44129011-44129033 AAGTAGAAGAATAATCAGAATGG - Intronic
1096372038 12:51076839-51076861 CACTCTTAGAATAATGAGATGGG + Intronic
1097982405 12:65747761-65747783 CAATTTTAGGATAATGAAAAGGG + Intergenic
1098386300 12:69922377-69922399 CAGGATTAGAAAATTTAGAAGGG + Intronic
1099040820 12:77652373-77652395 AAGTAGTACAATAAAGAGAAAGG - Intergenic
1100378852 12:94043228-94043250 CTTTATTAGCAGAATGAGAATGG - Intergenic
1100879845 12:99004574-99004596 CTGTTTGAGAAAAATGAGAAAGG + Intronic
1101218674 12:102612859-102612881 CAGTATTCAAATAATTAAAAAGG + Intergenic
1101867952 12:108536582-108536604 CAGAATTAGTAAAATTAGAAAGG + Intronic
1104190286 12:126475607-126475629 CTTTATTAGCAGAATGAGAATGG - Intergenic
1107712471 13:43163867-43163889 AAGTATTAGGGCAATGAGAAAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108716810 13:53088113-53088135 AAATTTTAGAATAACGAGAATGG - Intergenic
1108743847 13:53369167-53369189 CAGTATGACACTACTGAGAAAGG - Intergenic
1108996611 13:56741858-56741880 CAGTTTTAGACTAATGCGAAAGG - Intergenic
1110146654 13:72200370-72200392 CAGTATTAGTAAAATATGAATGG - Intergenic
1110394767 13:75016635-75016657 AAGTAGTAGAATAGAGAGAAAGG + Intergenic
1111601482 13:90480887-90480909 CTTTATTAGTATCATGAGAATGG - Intergenic
1112840916 13:103576718-103576740 CTTTATTAGTAGAATGAGAATGG + Intergenic
1115006977 14:28498074-28498096 TATTACTAGAATAATGATAAAGG - Intergenic
1115524451 14:34266001-34266023 GAGTCTTGGAATAATGAGAAGGG - Intronic
1117077709 14:52121405-52121427 CAAGATTAGGATTATGAGAAGGG + Intergenic
1118775846 14:68973579-68973601 CTTTATTAGAAGCATGAGAATGG + Intronic
1119981421 14:79086076-79086098 TAGTATTAGAATCATGAGACTGG - Intronic
1120262003 14:82197645-82197667 CAGCATTAGAATAACTATAAAGG - Intergenic
1123504578 15:20927558-20927580 CAGGATTACAATAATGTGATAGG + Intergenic
1123561825 15:21501259-21501281 CAGGATTACAATAATGTGATAGG + Intergenic
1123598069 15:21938540-21938562 CAGGATTACAATAATGTGATAGG + Intergenic
1123785670 15:23669671-23669693 AAGGATGAGAATAAAGAGAAGGG - Intergenic
1124086575 15:26556362-26556384 TCGTTTTAGAAGAATGAGAAAGG + Intronic
1124357445 15:29006488-29006510 CTGTATTAGCAGCATGAGAATGG - Intronic
1125089040 15:35769473-35769495 CTGAAATGGAATAATGAGAATGG + Intergenic
1125718633 15:41834579-41834601 CAGTAATAGAAAGATGAGGACGG - Intronic
1126255973 15:46626432-46626454 CATTATTAGTAGCATGAGAATGG + Intergenic
1127216199 15:56825253-56825275 CGGTTTTAGAATAAAGAGAGAGG + Intronic
1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG + Intergenic
1129422081 15:75436612-75436634 TAGTAGTAGAAAAATGATAATGG + Intronic
1129620907 15:77144755-77144777 CAGTTTTAGACTTAGGAGAATGG - Intronic
1202970170 15_KI270727v1_random:228385-228407 CAGGATTACAATAATGTGATAGG + Intergenic
1133505925 16:6412177-6412199 CAGTATTTGACTACTGTGAAAGG - Intronic
1133705565 16:8351559-8351581 CTGTGTTAGAATAATTAGATGGG + Intergenic
1136729145 16:32390906-32390928 TCGTATTAGAATAATGTTAAGGG - Intergenic
1137306149 16:47202441-47202463 CATTTTTAAAATTATGAGAAGGG - Intronic
1137806341 16:51309562-51309584 CTTTATTAGAAGCATGAGAATGG + Intergenic
1137855250 16:51788338-51788360 TAGGATTAGAAAAATGGGAATGG + Intergenic
1140002036 16:71035855-71035877 CAGTAAGAGAAGAAAGAGAAAGG + Intronic
1140160471 16:72486502-72486524 CAGTATTAAAATCAAGAGAAAGG - Intergenic
1140600234 16:76467115-76467137 TAGTATTATAATAATGTGCAAGG - Intronic
1141275984 16:82588649-82588671 CAGTATCTGAACCATGAGAATGG + Intergenic
1141603479 16:85139920-85139942 CAGTCTTGGAATAATCAGGAGGG + Intergenic
1141852188 16:86654004-86654026 GAATTTTAGAATTATGAGAAGGG - Intergenic
1202997255 16_KI270728v1_random:126618-126640 TCGTATTAGAATAATGTTAAGGG + Intergenic
1203023942 16_KI270728v1_random:438960-438982 TCGTATTAGAATAATGTTAAGGG + Intergenic
1143180519 17:4981513-4981535 AGGTATTAGAATACGGAGAAAGG - Intronic
1144794733 17:17883351-17883373 CATTATTAGAAGAATGAAACAGG + Intronic
1146931269 17:36779895-36779917 CAGTATTAATATAATGACAGTGG + Intergenic
1147014185 17:37477394-37477416 CAGATTTAAAATAAAGAGAAAGG + Exonic
1148512493 17:48184371-48184393 CAGTCGAAGAATAAAGAGAATGG + Intronic
1148592653 17:48828299-48828321 CAGATTTAGAATTATGAGAGGGG - Intergenic
1150900624 17:69272862-69272884 CAGTATTAAAATAATAAGCATGG - Intronic
1151588882 17:75030146-75030168 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
1154084404 18:11289017-11289039 CGTTATTATAATAATTAGAAAGG + Intergenic
1154135066 18:11770000-11770022 CAGAATTAGAATCATAGGAAGGG + Intronic
1154366051 18:13710130-13710152 CAAGATTAGAATTATGGGAAGGG + Intronic
1155016427 18:21845308-21845330 CACTATTAGAAGAATGAAAAGGG - Intronic
1155226123 18:23730806-23730828 CAGGCTTAGAATAATCATAAAGG - Intronic
1155261757 18:24050171-24050193 AATTATGAGAACAATGAGAAAGG - Intronic
1155283687 18:24267087-24267109 CAGTATTAGAAAAAAGAAAATGG + Intronic
1155523852 18:26696833-26696855 CAGTATTAGCATAAATAGAAAGG - Intergenic
1155758319 18:29530645-29530667 GAGTATTATAATAATAAGAGTGG + Intergenic
1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG + Intergenic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1158653491 18:59308204-59308226 CAGTATTAGAATAAAAAGCATGG + Intronic
1158669402 18:59461407-59461429 CATAATTAAAATTATGAGAAAGG - Intronic
1158753427 18:60293600-60293622 TAGTATGAGAAGAAAGAGAATGG - Intergenic
1159178982 18:64876890-64876912 CTTTATTAGCAGAATGAGAATGG - Intergenic
1159295727 18:66485247-66485269 TAAAATTAAAATAATGAGAATGG - Intergenic
1159565502 18:70043390-70043412 CAATATTAGGAGAATGAGAAGGG + Intronic
1159932104 18:74323745-74323767 CAATATAACATTAATGAGAAAGG + Intronic
1159977741 18:74736310-74736332 TAGGATTAGAATAATTATAAAGG + Intronic
1160280297 18:77484009-77484031 CAGTATTAACATGATGTGAAAGG + Intergenic
1164845499 19:31429194-31429216 CATGCTTAGAGTAATGAGAAAGG + Intergenic
1166599690 19:44083101-44083123 CAGTTTTAATATCATGAGAAAGG + Intronic
1166609124 19:44173449-44173471 CAGTTTTAGTATTATAAGAAAGG + Intronic
925605223 2:5653656-5653678 AAGTATTACAAAAATGACAAAGG - Intergenic
926472474 2:13278402-13278424 CAGCATTTGAAAAATAAGAAAGG + Intergenic
926536023 2:14113731-14113753 CATTATTATAATAAGGAAAAGGG + Intergenic
926562274 2:14430702-14430724 GAATATTAGAAGAAGGAGAAAGG - Intergenic
926782129 2:16483002-16483024 CAGTGTTAGAAAAATAACAAGGG + Intergenic
927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG + Intergenic
927374233 2:22394752-22394774 AAGGATTATAATGATGAGAAAGG + Intergenic
927392173 2:22607796-22607818 CAGTAATTGAAAAATGAAAAAGG + Intergenic
928352990 2:30579841-30579863 CTGTCTTAGAATACTAAGAAGGG - Intronic
928774615 2:34745280-34745302 AAGTATGATAATAATAAGAAGGG - Intergenic
930164412 2:48190181-48190203 CAGGATTAGGATTATGAGAGGGG - Intergenic
930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG + Intergenic
930746652 2:54890845-54890867 CAATATTAGGATAAGAAGAAAGG + Intronic
930792174 2:55345307-55345329 CAGTATTAGGATAAGAAGGAGGG - Intronic
932985025 2:76715733-76715755 CAGAATAAGAAACATGAGAACGG + Intergenic
933520487 2:83365874-83365896 CAGGATAAGAATAATAAGAGTGG + Intergenic
934185431 2:89668812-89668834 TCGTATTAGAATAATGTTAAGGG - Intergenic
934316974 2:91931595-91931617 TCGTATTAGAATAATGTTAAGGG + Intergenic
935318391 2:101860567-101860589 CAGTCTTAGAATTCTGAGCAAGG + Intronic
936721140 2:115254096-115254118 CTTTATTAGAAGCATGAGAATGG - Intronic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
936932206 2:117801668-117801690 CGATATTAGATTAATGAGAAGGG - Intergenic
937106331 2:119317955-119317977 CAGTGTTTGAATACTGAGAGTGG - Intronic
937767026 2:125673367-125673389 CAATATAATAATAATGAAAAAGG - Intergenic
938335776 2:130495273-130495295 AAGTAGTAAAATAATGAAAATGG + Intronic
938544293 2:132313927-132313949 CTTTATTAGAAACATGAGAATGG + Intergenic
939345203 2:140956337-140956359 AAGTATTAGTATAATCAGCATGG - Intronic
939447015 2:142323144-142323166 CTTTATTAGAATAATGAAAGGGG - Intergenic
939450733 2:142370613-142370635 CACTTTTAGAAGAATGACAAAGG + Intergenic
940393357 2:153159128-153159150 CAGTTTTAGTATAAAGAAAATGG - Intergenic
940535315 2:154934037-154934059 CAGTATTAGACAAATCAAAAAGG - Intergenic
940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG + Intergenic
940658207 2:156514683-156514705 CAATATTAGAAAAATGTTAAGGG + Intronic
940761234 2:157741678-157741700 GAGGAGCAGAATAATGAGAAAGG + Intronic
941737518 2:168995404-168995426 CTTTAGGAGAATAATGAGAATGG - Exonic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942679942 2:178467578-178467600 GAGGATTAGAATAATGATTATGG + Intronic
944109526 2:196117295-196117317 CAGAAATAGAATAATTACAATGG - Intergenic
945267936 2:207909936-207909958 CACTATTAGACTACTGAAAATGG + Intronic
945616338 2:212073147-212073169 CAGTATTAGAAAAGCTAGAAAGG + Intronic
946669382 2:222086113-222086135 TAGTATTTGAACAATGAAAAAGG - Intergenic
946732086 2:222719802-222719824 CTTTATTAGAAGCATGAGAATGG - Intergenic
947048880 2:226019712-226019734 CAGAATGAGAACAAAGAGAAGGG + Intergenic
947939127 2:234033745-234033767 CAGTCTGTGAATAATGGGAAAGG + Intergenic
948106288 2:235416860-235416882 AAGTATTAGGAGAAAGAGAAAGG - Intergenic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170156156 20:13271506-13271528 TAGTATTAGAAAAATGACACGGG - Intronic
1170440232 20:16371978-16372000 AAGTAATAGAATATTGGGAATGG + Intronic
1170489579 20:16858928-16858950 AAGTACTAGAAAAATGGGAAAGG + Intergenic
1171812697 20:29758016-29758038 GAGAAGTAGAATAAGGAGAAGGG + Intergenic
1171873158 20:30546664-30546686 CTTTATTAGAAACATGAGAATGG + Intergenic
1172822004 20:37744730-37744752 TTGTAGTAGAATAATGATAAGGG + Intronic
1173400179 20:42719250-42719272 CATAATTAAAATAATGAGATTGG + Intronic
1175163546 20:57026894-57026916 CAGAACTAGAACAATTAGAATGG - Intergenic
1177393041 21:20501257-20501279 CTTTATTAGAATCATGAAAACGG - Intergenic
1178220258 21:30648904-30648926 CATAATTAGAGAAATGAGAATGG + Intergenic
1178728939 21:35081182-35081204 CAGAGTTAGGATAATGAGAGGGG + Intronic
1178811765 21:35890045-35890067 CAGAATTTGATTAATGAAAACGG - Intronic
1179130159 21:38628978-38629000 CAGTACTAGTATACTGATAACGG - Intronic
1179359869 21:40695608-40695630 GAGTAATCGAATAAGGAGAAGGG - Intronic
1180543333 22:16474109-16474131 TCGTATTAGAATAATGTTAAGGG + Intergenic
1180652083 22:17386158-17386180 AAGTATTAGGAAAATGACAACGG + Intronic
1180700028 22:17776239-17776261 CAGTATTTGTAAAATGAGAGAGG + Intergenic
1181882231 22:25990173-25990195 CAGACTTACAATAATGTGAATGG + Intronic
950950093 3:16989919-16989941 CAGGATAGGAATAATAAGAAAGG + Intronic
951618339 3:24573088-24573110 CTGTAGTAGCATAATGAGAGAGG + Intergenic
951704144 3:25526842-25526864 CATTATTAAAATCATGAGTAAGG - Intronic
951750605 3:26030995-26031017 CACTAGTAGAAGAATGAAAAGGG + Intergenic
951926328 3:27912555-27912577 CAGTATTAGAAGATTGTCAAAGG - Intergenic
952271085 3:31832040-31832062 CTGTAAGAGAATAATGAGAGAGG + Intronic
953177998 3:40569119-40569141 CAAGGTTAGAATTATGAGAAAGG - Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
956028305 3:65007947-65007969 CAAGATTAAAATAATGAGATAGG + Intergenic
956646352 3:71460985-71461007 CAGTTTTACAATAAAGAGATGGG + Intronic
957697133 3:83653713-83653735 AAGTATAAGAATAAGGAAAATGG + Intergenic
958018997 3:87975440-87975462 CTGTATTTGAATGATAAGAAAGG - Intergenic
959212166 3:103399144-103399166 CTGTGGTAGAATAATGAGAATGG + Intergenic
959247029 3:103884323-103884345 CTTTATTAGAAGCATGAGAATGG - Intergenic
959277862 3:104299984-104300006 CAAAATTAGAATTATGAGAGGGG - Intergenic
959362444 3:105410251-105410273 CAGAATTAGCACAATGGGAAAGG + Intronic
959470759 3:106747220-106747242 CAGCATTATAAGAATTAGAAGGG - Intergenic
959662818 3:108888267-108888289 GAATATTAAAATAAAGAGAAAGG - Intergenic
960438803 3:117661332-117661354 CATTATTTTAATAATGGGAAAGG - Intergenic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961773381 3:129266643-129266665 CAGAATAATAAAAATGAGAAAGG - Intronic
964068875 3:152608220-152608242 TAGAATTAGAATAATGAGCCGGG + Intergenic
964454957 3:156854031-156854053 CAGTAATAGTATAATCAGCAGGG - Intronic
964609225 3:158592921-158592943 AAGTATTAAAACAATGAGTATGG - Intronic
965028852 3:163336797-163336819 AAGTAATTGAATAATGAGATGGG - Intergenic
965265475 3:166537452-166537474 AAGTTTTAGTATAATGAGACAGG + Intergenic
965425584 3:168518653-168518675 CTTTATTAGCAGAATGAGAATGG - Intergenic
965669479 3:171131868-171131890 TAGTATGAAAATAATGAAAAGGG - Intronic
970769964 4:19600357-19600379 CAGAACTGGAATAATTAGAAAGG + Intergenic
970794928 4:19899919-19899941 AAATATTAGAGTAATGATAAAGG - Intergenic
972078505 4:35117889-35117911 GATTATTACAATATTGAGAAAGG + Intergenic
972682114 4:41316132-41316154 CAATATTAGGATTATGAGAGAGG - Intergenic
974045254 4:56893003-56893025 CTTTATTAGCATCATGAGAATGG - Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974253102 4:59414482-59414504 AAGTATCTGAATACTGAGAAGGG + Intergenic
974303579 4:60102074-60102096 CAGTTTAAGAGCAATGAGAAAGG - Intergenic
976376026 4:84345978-84346000 AAGAATTAGTATAATGAAAATGG + Intergenic
976565865 4:86550334-86550356 CAGCATTATATTAATCAGAAGGG + Intronic
976887348 4:90001906-90001928 CAGTAGTAGAATACTGGGAAAGG + Intergenic
977840949 4:101703548-101703570 CAGTTTTAGAATTTTGAAAAAGG - Intronic
977890460 4:102304888-102304910 TATTTTTAGAATTATGAGAATGG - Intronic
978306509 4:107334315-107334337 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
979279628 4:118850869-118850891 CAATATTTGAGGAATGAGAAAGG + Intronic
979417008 4:120454161-120454183 CACAATTAGAAAAGTGAGAAAGG - Intergenic
979642682 4:123027608-123027630 AAGAAATAGAATAATGAGACAGG - Intronic
980028751 4:127799569-127799591 CAGTATAACAATTATGAGCATGG - Intronic
980323436 4:131308904-131308926 CAGTGTTAGAATAACGATTAGGG - Intergenic
981192060 4:141875805-141875827 CAGGATTAGAATTATGAGAGAGG + Intergenic
981834255 4:149036786-149036808 CACTATTAGCAGCATGAGAATGG + Intergenic
983147867 4:164240871-164240893 CAGGGTTAGAATTATGAGAGAGG + Intronic
983283375 4:165709068-165709090 GAATATTAGAATTAGGAGAATGG - Intergenic
985968393 5:3355140-3355162 AAGTAATAGAATCATGATAAGGG - Intergenic
987226471 5:15847151-15847173 CTGTATTAGTAGCATGAGAATGG - Intronic
989513698 5:42317757-42317779 CAGTTTTATCATAAAGAGAATGG - Intergenic
989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG + Intergenic
990080454 5:51906487-51906509 CTTTATTAGCATCATGAGAATGG + Intergenic
990260152 5:54013521-54013543 CAAGATTAGAATTATGGGAAGGG + Intronic
991619567 5:68531577-68531599 CAGCAAGAGAAAAATGAGAAGGG - Intergenic
992414269 5:76538000-76538022 CTTTATTAGCATCATGAGAATGG - Intronic
992548327 5:77837310-77837332 TAGCATTAGAATTATGACAATGG - Intronic
992953848 5:81888016-81888038 CAGGATCAGAGCAATGAGAACGG + Intergenic
993489833 5:88533770-88533792 CTTTATTAGTATCATGAGAATGG - Intergenic
993746109 5:91598938-91598960 CAGTCTTAGAAGAATGAGGTGGG - Intergenic
993802213 5:92356682-92356704 CTATATTACAATAATGATAAAGG - Intergenic
994447965 5:99901874-99901896 AAGTATTCGAATAATTAGAATGG - Intergenic
994776542 5:104041800-104041822 CAGTATGAGTATAAAGAGACTGG + Intergenic
996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG + Intergenic
996433560 5:123408454-123408476 CGGTATTAAAATAATAATAAAGG + Intronic
997885627 5:137627533-137627555 TAATATGAGAATAATGAAAATGG + Intronic
998626398 5:143851485-143851507 GAGTATTAGAAAAAACAGAAAGG + Intergenic
999421658 5:151449726-151449748 CTGTATTAGAACACTGAGCACGG + Intronic
999726352 5:154441464-154441486 CAGTCTCAGAACAATGTGAAAGG + Intergenic
999805855 5:155080656-155080678 AAGTATTATTCTAATGAGAAAGG - Intergenic
1000459220 5:161492353-161492375 AGGGAATAGAATAATGAGAAGGG - Intronic
1001015303 5:168135648-168135670 CAGTCTCAGGATAATTAGAATGG + Intronic
1001335059 5:170790014-170790036 CAGTTATAGCATAATGGGAACGG - Intronic
1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG + Intergenic
1003550583 6:7099009-7099031 GAGTATTAGAATGTGGAGAAGGG - Intergenic
1004361823 6:14978028-14978050 CACTATAAGAATAATGAGGTTGG - Intergenic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1007273519 6:40656576-40656598 AAGTATTAGAACAATGGGAAAGG - Intergenic
1008581993 6:52915904-52915926 TAGCATTAGAAGAAGGAGAAAGG - Intergenic
1008690342 6:53971814-53971836 CAGTATTAGCATCACGGGAAGGG - Intronic
1009754905 6:67924714-67924736 ATGTATCAGAATCATGAGAATGG + Intergenic
1009761990 6:68018957-68018979 CAGTATTAGTATACAGAGAAAGG - Intergenic
1009798218 6:68499574-68499596 CAGAAATAGAATAAAGAGGAAGG - Intergenic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010906973 6:81502494-81502516 CTTTACTAGAAGAATGAGAATGG + Intronic
1011494511 6:87925248-87925270 TGGTATTAGAACGATGAGAAAGG - Intergenic
1011496602 6:87942935-87942957 CAGTATTAGACGGAAGAGAAGGG + Intergenic
1011846562 6:91570917-91570939 CAGTATTAGAAAACTGTAAAAGG - Intergenic
1012060395 6:94471340-94471362 TAGTACTAGAATAAGGAGGAGGG - Intergenic
1014241122 6:119018541-119018563 CAGGAATAAAATAATGAGATGGG + Intronic
1014330826 6:120061412-120061434 CTGTATTAGCAGCATGAGAATGG - Intergenic
1014620890 6:123666013-123666035 CAGTGTGAGAATATTGAAAATGG - Intergenic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1015859215 6:137657851-137657873 CAATATTAGGAAAATGTGAAGGG + Intergenic
1016142350 6:140627846-140627868 CATTATTAGCAGCATGAGAATGG - Intergenic
1016385200 6:143524103-143524125 CTTTATTAGAATCATAAGAATGG + Intergenic
1016513161 6:144865612-144865634 CAATATTAGGATTATGAGAGGGG + Intergenic
1016682454 6:146846106-146846128 CTGTATTAGCAGCATGAGAATGG - Intergenic
1017543023 6:155422518-155422540 CAGTATTACATTTATGAGTAGGG - Intronic
1018217986 6:161549556-161549578 AAGAATAAGAATAATGATAAAGG - Intronic
1018300851 6:162401723-162401745 CAAAATTAAAATAAGGAGAATGG + Intronic
1019034672 6:169044393-169044415 CTGTATTAGAAGAAAAAGAAAGG + Intergenic
1020826107 7:13031019-13031041 TAGTATTATAATTAAGAGAATGG + Intergenic
1020998012 7:15289460-15289482 CAGTATTACAATAATGACTCTGG + Intronic
1022421061 7:30223849-30223871 CAGTATGTGTAGAATGAGAAAGG + Intergenic
1023431428 7:40095367-40095389 CAGTTTTACAACAATCAGAAAGG + Exonic
1024408597 7:49012351-49012373 CAGTATTAGACAAATCAGCAAGG + Intergenic
1026268583 7:68816906-68816928 GTGTATTAGAATAATAACAAGGG + Intergenic
1027596701 7:80183344-80183366 TAGCATTATAATAAAGAGAAAGG + Intronic
1027653127 7:80896375-80896397 CAGTAATAGAGAAATGAGAAAGG - Intronic
1027758711 7:82249853-82249875 CAGTATGAGAGTTTTGAGAAGGG + Intronic
1027893597 7:84010729-84010751 CATTATTATAATAATGTAAAAGG + Intronic
1028054904 7:86229204-86229226 CAGTAATAAAAAAATGAGAATGG + Intergenic
1030984500 7:116225357-116225379 CAGTATTAAGTTAATGACAAAGG - Intronic
1031448820 7:121888546-121888568 CAGAATTAGAATTAGGATAATGG + Intronic
1031549111 7:123086201-123086223 CAGTATCAGAAAAAGGAGAATGG + Intergenic
1034040577 7:147873295-147873317 CCTTATTAGCAGAATGAGAATGG - Intronic
1034063415 7:148113865-148113887 CAGTAACAGAATAATGAGGCAGG - Intronic
1034444059 7:151103080-151103102 CAGTATGAGAACTAAGAGAAAGG - Intronic
1037143189 8:15541567-15541589 CAGACTAAGAATAAAGAGAAAGG - Intronic
1037357681 8:18040007-18040029 CCCTCTGAGAATAATGAGAAAGG + Intergenic
1038053648 8:23837325-23837347 CATTATTTAAAAAATGAGAAGGG + Intergenic
1038687840 8:29734523-29734545 CAGTATAAGAACAGAGAGAATGG - Intergenic
1039053128 8:33512769-33512791 CGGGATAAGAATAAAGAGAAAGG + Intronic
1039483297 8:37891648-37891670 CAGTTTAAGTAAAATGAGAAAGG + Intronic
1040875250 8:52144048-52144070 CAGTATTAAACTTAAGAGAAGGG - Intronic
1041219736 8:55637284-55637306 CAGTAGTTGGAAAATGAGAAGGG + Intergenic
1042067012 8:64889102-64889124 CCTTATTAGAAAAATTAGAAAGG - Intergenic
1042438153 8:68792205-68792227 TAGAATTAGAATGATGAGAAAGG + Intronic
1043217699 8:77615881-77615903 CAGTATTAGAAAAATGTTTAAGG - Intergenic
1043463559 8:80484901-80484923 CAGTTATAGATTAATGGGAAGGG - Intergenic
1044585945 8:93869368-93869390 CAGTAATAGAATTGTGGGAAGGG + Intronic
1045692172 8:104771159-104771181 CAAGGTTAGAATTATGAGAAGGG - Intronic
1045916394 8:107476643-107476665 CACATTTAGAAAAATGAGAATGG + Intronic
1046058440 8:109107081-109107103 CAGTTGTATAATAAAGAGAATGG + Intronic
1046835419 8:118795562-118795584 CTTTATTAGCATCATGAGAATGG + Intergenic
1046988810 8:120425216-120425238 CTATATTAAAATAATGAGAAGGG + Intronic
1047802569 8:128325264-128325286 CAGCATTAGATAAATGACAATGG - Intergenic
1048906157 8:139091441-139091463 CAGTATTCTAAGACTGAGAATGG - Intergenic
1050712403 9:8480485-8480507 CTGTATGAGAACAATGAGAAAGG + Intronic
1051741281 9:20254748-20254770 CTTTATTAGAATTGTGAGAATGG - Intergenic
1051986498 9:23095805-23095827 CTTTATTAGCATCATGAGAATGG + Intergenic
1052088946 9:24303263-24303285 CAGAAGGAGAAAAATGAGAAAGG - Intergenic
1052111003 9:24581251-24581273 TAATATTAGAATAATGAAAAAGG - Intergenic
1052170445 9:25389329-25389351 GAGGAGTAGAATCATGAGAAAGG - Intergenic
1056784320 9:89579204-89579226 CCTTATTAGCAGAATGAGAATGG - Intergenic
1058408107 9:104699983-104700005 CAGTATTAAAAAAATGACATAGG + Intergenic
1058854423 9:109046477-109046499 CAGAATCAAAATAATGAGTAAGG + Intronic
1059215560 9:112558259-112558281 AAAAATAAGAATAATGAGAAGGG + Intronic
1059338781 9:113585621-113585643 CAGGATTAGAATAAACAGAGAGG + Intronic
1059509245 9:114828494-114828516 CAGTATCAGTATCATCAGAATGG - Intergenic
1061604891 9:131701519-131701541 CAGTATTACAATAATGCCAGTGG - Intronic
1186057965 X:5671602-5671624 CTTTATTAGCAGAATGAGAATGG - Intergenic
1186072223 X:5834569-5834591 CAGTATTGGGAAAATGAGAAAGG - Intergenic
1186694835 X:12019287-12019309 CAGAACTAGGATAATGACAACGG - Intergenic
1186717953 X:12273496-12273518 CAGAAATAAAATAATGAAAATGG + Intronic
1188054689 X:25527528-25527550 CTTTATTAGCAGAATGAGAACGG - Intergenic
1188613574 X:32129958-32129980 AAGTCTTTGAAAAATGAGAAAGG - Intronic
1188804025 X:34565290-34565312 AAGTATTACAAGAATGAGATAGG - Intergenic
1189054093 X:37680313-37680335 CAGTATGAGATTTATGATAATGG - Intronic
1189136280 X:38554010-38554032 CATTATTGGAATAGTGAAAATGG - Intronic
1189587850 X:42478891-42478913 AAATATCAGACTAATGAGAAGGG + Intergenic
1189906636 X:45767342-45767364 GAGTAGGAGGATAATGAGAAGGG - Intergenic
1191055446 X:56235073-56235095 ATGTATTAGAACAATGAGAGTGG - Intronic
1192076428 X:68002642-68002664 CAGTTTTAGAAAAAATAGAAAGG + Intergenic
1193211018 X:78806936-78806958 CTTTATTAGCATCATGAGAATGG + Intergenic
1194101704 X:89713527-89713549 CAGAACAAGAACAATGAGAAAGG - Intergenic
1194166813 X:90526567-90526589 TAGTATTAGAATAATATGACTGG + Intergenic
1194736962 X:97523618-97523640 CAATATTTGAAAAATGAAAAAGG + Intronic
1194851838 X:98880473-98880495 CTTTATTAGCATAATGAGAACGG - Intergenic
1196982423 X:121229786-121229808 CAGTATTAGACTGATCAGCAAGG - Intergenic
1197237391 X:124082721-124082743 CAGTTTTAGAAGAAAGTGAAAGG - Intronic
1197514982 X:127415883-127415905 CAGAAAAGGAATAATGAGAAAGG - Intergenic
1198231652 X:134695705-134695727 CAGGATTAGAATGATCACAAAGG - Intronic
1199113903 X:143967130-143967152 GAGTATTAGGATAGTGGGAATGG - Intergenic
1199409740 X:147507334-147507356 TGGTATTAGAAAAATGAGTAAGG - Intergenic
1199528224 X:148816561-148816583 CAGTATTAGAATAATGAGAATGG + Intronic
1199560773 X:149160385-149160407 CATTATTAGAAGCATCAGAATGG - Intergenic
1200454652 Y:3374611-3374633 CAGAACAAGAACAATGAGAAAGG - Intergenic
1200513079 Y:4104348-4104370 TAGTATTAGAATAATATGACTGG + Intergenic
1201184207 Y:11382894-11382916 TCGTATTAGAATAATGTTAAGGG + Intergenic
1201589879 Y:15603391-15603413 CTTTATTAGCAGAATGAGAATGG - Intergenic
1201613277 Y:15866854-15866876 CACTATTCTAATAATGGGAAGGG + Intergenic