ID: 1199529773

View in Genome Browser
Species Human (GRCh38)
Location X:148833237-148833259
Sequence CATGCGAATCACCTTGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199529773_1199529777 4 Left 1199529773 X:148833237-148833259 CCCCTCTCAAGGTGATTCGCATG 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1199529777 X:148833264-148833286 GCAGTGAACGCTTCAAAAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199529773 Original CRISPR CATGCGAATCACCTTGAGAG GGG (reversed) Intronic
904714986 1:32460919-32460941 CATGAGAATCAACTTGAGCCTGG - Intergenic
905824326 1:41017366-41017388 CAGGCGGATCACCTTGGTAGGGG + Exonic
907156462 1:52339379-52339401 CATGAGAATCACCTTGAACCTGG - Intronic
907264321 1:53247473-53247495 CATGCTAATCACATTTAGAAAGG + Intronic
915335096 1:155136314-155136336 CATGCGAATGACCCGGAGTGTGG + Exonic
915926256 1:160022115-160022137 CATGAGAATCAACTTGAGCCTGG + Intergenic
920729474 1:208469479-208469501 CATTAGAATCACCTGGATAGAGG + Intergenic
1063169240 10:3491812-3491834 CATCAGAATCCACTTGAGAGTGG + Intergenic
1064883706 10:20085744-20085766 CAAGAGAATCATCTTGAGGGAGG - Intronic
1069469802 10:68677845-68677867 CAGGCGAATCACCTGAAGTGGGG - Intronic
1069511745 10:69047752-69047774 CCTGAGAATCACCTGGGGAGAGG - Intergenic
1074355935 10:112783076-112783098 CTTCAGAATCAACTTGAGAGAGG - Intronic
1079386911 11:19988709-19988731 CATGAGACTCTCCTTGAGAGAGG - Intronic
1083568117 11:63737675-63737697 CATACTATTCACCTGGAGAGGGG + Intronic
1092941917 12:13417891-13417913 CATAAGAATCACCTGAAGAGTGG + Intergenic
1094094547 12:26688813-26688835 CATGCAAATCACCGTGAAAGTGG - Intronic
1095112007 12:38305975-38305997 AATGTGAATTACCTTGAAAGAGG + Intergenic
1100745707 12:97643428-97643450 CATCCTAATCACCTAGTGAGGGG + Intergenic
1101664373 12:106797249-106797271 CATGCCCATCACCTGGTGAGTGG + Intronic
1106863956 13:33942967-33942989 CATAGGAAACACCTTCAGAGTGG + Intronic
1107883571 13:44855238-44855260 CATGTTAATCACCTTGTGAGGGG - Intergenic
1109500200 13:63226196-63226218 CCTGAGAATCACATTGAGTGGGG - Intergenic
1115418694 14:33167300-33167322 CATTCAAATCTCCTAGAGAGAGG + Intronic
1118167557 14:63352810-63352832 CAGGAGAATCACCTTGAGCCTGG - Intergenic
1202828306 14_GL000009v2_random:638-660 CATGAAAATCACCTTGGGACTGG + Intergenic
1128700519 15:69800988-69801010 GATTCTAAGCACCTTGAGAGTGG - Intergenic
1129992281 15:79975505-79975527 CAGGCGAATCACCTTAGGTGAGG + Intergenic
1134336721 16:13306616-13306638 CATGTGAATCATCTTGGAAGTGG - Intergenic
1138094312 16:54200133-54200155 CGTCAGAATGACCTTGAGAGGGG - Intergenic
1140889055 16:79269738-79269760 CATGCAAATCGCCCTGAGTGAGG + Intergenic
1141342085 16:83212733-83212755 CGTGAGAATCACCTGGGGAGGGG + Intronic
1147422185 17:40327361-40327383 CTTGGGCCTCACCTTGAGAGAGG + Intronic
1147529026 17:41256036-41256058 CTTGTGAATCAGCTTGAGGGAGG + Exonic
1147529967 17:41266310-41266332 CTTGGGAATCAGCTTGAGGGAGG + Exonic
1147530521 17:41271981-41272003 CTTGTGAATCAGCTTGAGGGAGG + Intergenic
1150326907 17:64264564-64264586 CATTAGAATCACCTGGAGGGAGG - Intergenic
1153521954 18:5962163-5962185 CATGCTAACACCCTTGAGAGAGG + Intronic
1202644392 1_KI270706v1_random:127182-127204 CATGAAAATCACCTTGGGACTGG - Intergenic
926122386 2:10251236-10251258 CATCAGAATCACCTGGAGGGAGG + Intergenic
926967689 2:18433196-18433218 CAGGCCAACCTCCTTGAGAGCGG + Intergenic
927813681 2:26195221-26195243 CATGCCAATCACCTGGCAAGGGG + Exonic
937496317 2:122423936-122423958 CATGAGAATGACCTTAACAGTGG + Intergenic
942821400 2:180120130-180120152 GATTAGAATCACCTGGAGAGTGG + Intergenic
946155254 2:217802875-217802897 TATGCGAGTCCCCTAGAGAGAGG - Exonic
947434218 2:230059094-230059116 CATGGGCATCACCTTGATAGTGG - Exonic
1169053929 20:2604361-2604383 CATGCTTATCACTTTGAGAGAGG + Intronic
1171182313 20:23099749-23099771 CATGGGAATCACCTGGGGTGGGG + Intergenic
1175604292 20:60299563-60299585 GATGAGTATCACCTGGAGAGAGG + Intergenic
1176607488 21:8845472-8845494 CATGAAAATCACCTTGGGACTGG + Intergenic
1180357574 22:11855259-11855281 CATGAAAATCACCTTGGGACTGG + Intergenic
1180380691 22:12137074-12137096 CATGAAAATCACCTTGGGACTGG - Intergenic
950921439 3:16698626-16698648 CATGAGAATCACCTAGTGTGTGG + Intergenic
951339663 3:21469211-21469233 CATGCGAATCATTATGAGTGAGG - Intronic
951646291 3:24895359-24895381 CATCAGAATCACCTGGAAAGTGG + Intergenic
956350822 3:68334181-68334203 CATGCTAATCAGCTTGATTGTGG + Intronic
959468127 3:106715508-106715530 CATGGGAAGGACCTTGAGGGAGG + Intergenic
962630842 3:137274017-137274039 TATGCAAAACACCTTGAGAGTGG - Intergenic
962729747 3:138269874-138269896 CATAAAAATCACCTTGAGAAGGG - Intronic
975180561 4:71339389-71339411 CATCCGATTCATCTTGGGAGAGG + Exonic
986058882 5:4168987-4169009 AATGCCCATCAACTTGAGAGTGG + Intergenic
993574756 5:89587142-89587164 CACCTGAATCACCTTGGGAGAGG + Intergenic
995709691 5:115022261-115022283 CATCAGAATCACCTGGGGAGAGG - Intergenic
996534399 5:124562167-124562189 AATGTGAATCAACTTGAGATTGG - Intergenic
1001282409 5:170396256-170396278 CAGGAGAATCTTCTTGAGAGGGG + Intronic
1004467403 6:15898651-15898673 CAGGGCAATGACCTTGAGAGTGG - Intergenic
1007069008 6:39021339-39021361 CATGGGAATCACCTGAGGAGGGG - Intronic
1010003476 6:70971266-70971288 CATCAGAATCACCTGGAGGGAGG + Intergenic
1013053903 6:106564532-106564554 CATCAGAATCACCTGGAGGGCGG + Intronic
1013391148 6:109687637-109687659 AATGTGAATCAGCTTGGGAGTGG + Intronic
1019390894 7:786646-786668 CATAGGACTCACCTTGAGAGGGG + Intergenic
1019828764 7:3304930-3304952 CATGAGAATCACCTGGAGGGAGG - Intronic
1023360776 7:39413254-39413276 CATGGTAATCACCTTGGGAATGG - Intronic
1026373314 7:69723920-69723942 TCTGGGAATCACCTGGAGAGAGG + Intronic
1026529054 7:71181565-71181587 CATCAGAATCACCTTGATGGGGG + Intronic
1035960127 8:4127258-4127280 CATGAGAATAACCTGGAGCGGGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1038826874 8:31013112-31013134 GATGCAAATCACCTTAACAGAGG + Intronic
1038885547 8:31659053-31659075 CATGAGAAACATCTGGAGAGTGG - Intronic
1041487922 8:58399430-58399452 CATGGGAATAACCTAGTGAGAGG - Intergenic
1044809165 8:96039582-96039604 CATGCAAATGAGCTTGAAAGTGG + Intergenic
1049495159 8:142926673-142926695 CTTGCCAATCACTTTGAGAGGGG + Intergenic
1050281939 9:4059583-4059605 CATGGGAATAACCTGGAGACTGG + Intronic
1050756708 9:9013285-9013307 TTTGCCCATCACCTTGAGAGTGG - Intronic
1052956355 9:34255813-34255835 CTTGCTAAGCACCTTGAGATCGG + Exonic
1203702824 Un_KI270742v1:10360-10382 CATGAAAATCACCTTGGGACTGG + Intergenic
1190888562 X:54550270-54550292 AATGAGAATGACCTAGAGAGAGG + Intronic
1193660575 X:84252461-84252483 CATTGGAATCACCTTCAGATTGG + Intergenic
1199055300 X:143286951-143286973 AATGAGAATAAACTTGAGAGTGG + Intergenic
1199529773 X:148833237-148833259 CATGCGAATCACCTTGAGAGGGG - Intronic
1199611566 X:149620882-149620904 CTTGTGAATCACCTTGACACAGG - Intronic