ID: 1199531403

View in Genome Browser
Species Human (GRCh38)
Location X:148851770-148851792
Sequence GTTTGGGGGTGCATGTGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199531403 Original CRISPR GTTTGGGGGTGCATGTGACA CGG Intronic
901215901 1:7555302-7555324 ATTTGGGGGTGCATGTGGGTAGG + Intronic
902293390 1:15449705-15449727 GCTTGGAGGGGCAAGTGACAAGG + Intergenic
902385988 1:16076248-16076270 CTTTGGGGGTAGATGGGACAGGG + Intergenic
904327669 1:29738041-29738063 GTTTGGGGGGGACTGTGGCAGGG + Intergenic
904969753 1:34409976-34409998 GTTTGGAGGTGCATGTTAGGTGG + Intergenic
905059907 1:35131119-35131141 CTAAGGGGGTGCATGTGAGAGGG + Intergenic
905061477 1:35143326-35143348 GTTTGGGGGTGCACCTGACTCGG + Intergenic
905468164 1:38171480-38171502 GTTGGTGTGTGCATGTCACAGGG - Intergenic
905480188 1:38256443-38256465 GTGCGTGTGTGCATGTGACATGG - Intergenic
905892580 1:41526566-41526588 GTGTGGGGGTGTATGTGTGAGGG - Intronic
906554794 1:46701001-46701023 GTGTGTGTGTGCATGTGAGATGG + Intronic
907763871 1:57389095-57389117 GTTTGGGGGTGCATAGGACAAGG - Intronic
909427367 1:75541803-75541825 GGTTAGGGGTGCATTTTACAGGG - Intronic
915143265 1:153779688-153779710 GTTTAGGGGAGGAGGTGACAGGG - Intronic
915831070 1:159130683-159130705 GTTTGAGGGTATATGTGATATGG - Intronic
916283900 1:163083084-163083106 GTTTGGGGAGGCATTTTACAGGG + Intergenic
917418728 1:174839326-174839348 GTGTGGATGTGCATGTGAGAGGG - Intronic
918102108 1:181385468-181385490 GTTGGGGAGTGGAGGTGACAGGG + Intergenic
918924152 1:190758708-190758730 TTTTGGGGGTACATGTGATTAGG + Intergenic
919738908 1:200970966-200970988 GATTGGGGGTGCCTGTGTCTGGG - Intronic
919758072 1:201078229-201078251 TTTTGGGGGTGCAGGGGGCAGGG + Intronic
919848764 1:201658378-201658400 GTGTGGGGGCACATGTGAGATGG + Intronic
922066812 1:222152178-222152200 GATTGGGGGTGCATGTGTTTGGG + Intergenic
924947439 1:248855891-248855913 CTTTAGGTGTGCAGGTGACAGGG + Exonic
1063685290 10:8231226-8231248 TTTTGCTGGTGCAGGTGACAGGG + Intergenic
1064290611 10:14030909-14030931 GGTTGTGGGTGCATGAGCCAGGG - Intronic
1066201081 10:33143178-33143200 GTTAGGGGATGCATGGGTCAAGG + Intergenic
1066508157 10:36066489-36066511 GGCTGGGTGTGCATGTGCCAAGG + Intergenic
1069871643 10:71536686-71536708 GTTTGGGTCTGGATGGGACAGGG - Intronic
1070054582 10:72923118-72923140 CTTTGGGGGTCCAAGTCACATGG - Intronic
1070481737 10:76889679-76889701 GTTGGAGGGTCCATGTGCCAAGG + Intronic
1070487339 10:76943400-76943422 CTTTGGTGGTGCATGTGAAATGG - Intronic
1071751804 10:88487298-88487320 GTTCAGGGGTGCATGTGTCATGG - Intronic
1071983440 10:91027141-91027163 GTTTGAGGGTGTATGTGTCGAGG - Intergenic
1072519075 10:96214345-96214367 GTTTGGGGGTAGGGGTGACATGG + Intronic
1073155323 10:101341873-101341895 GTTTGGGGGTGGATGAGAGCTGG - Intergenic
1075569068 10:123526066-123526088 GTTTGGCGGGGCATTTGGCAGGG + Intergenic
1076099580 10:127764939-127764961 ATTAGGGGGTCCATGGGACATGG - Intergenic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1077185583 11:1234064-1234086 GTTGGGGGCTGCAGGTGTCATGG + Intronic
1077776388 11:5276492-5276514 GTTCTGGGGTACATGTGCCATGG - Intronic
1078472372 11:11601618-11601640 GTTTGGGGGTTCTTTTGGCAGGG + Intronic
1078900358 11:15636434-15636456 GTTAGGTGGTGCATTTAACATGG + Intergenic
1081155410 11:39683921-39683943 GATTGGGGGTGTGTGTGGCAGGG - Intergenic
1081581658 11:44356387-44356409 GCATCTGGGTGCATGTGACATGG - Intergenic
1083654616 11:64223525-64223547 GCTTGGGAGTGGCTGTGACAGGG - Exonic
1084212019 11:67628763-67628785 GTGGGGTGGTGCATGTGACCAGG + Intronic
1085590303 11:77753911-77753933 GGTTGGGGGTGCAAGAGAAATGG - Intronic
1086132264 11:83413159-83413181 GTTGGGGGGTGCAGGGGAAAGGG - Intergenic
1092365208 12:7871763-7871785 GGGTGGGGATGCATGTGAAATGG - Intronic
1093802573 12:23391223-23391245 GTTTGTTGCTGCATGTGAGATGG - Intergenic
1093804774 12:23418523-23418545 GTTTGTTGCTGCATGTGAGACGG - Intergenic
1096226605 12:49870212-49870234 GTTTGAGGGTCCAAGGGACAAGG - Exonic
1096513008 12:52142183-52142205 GGTTGGGGTTGCATGTGCCTTGG + Intergenic
1096912078 12:54994582-54994604 GTTCAGGGGTACATGTTACATGG + Intergenic
1100229086 12:92589047-92589069 ATTTGGGGGTGTATGGGAAAAGG - Intergenic
1100777784 12:97991285-97991307 GTTTGGGGGTTGTTGTGAAATGG + Intergenic
1103955773 12:124575981-124576003 GGCTGGGGGAGGATGTGACAAGG + Intergenic
1104636594 12:130441528-130441550 GTCCAGGGGTGCATGTGACACGG + Intronic
1105407009 13:20141738-20141760 GTTTGGGGGTGGCGGGGACAAGG - Exonic
1106702821 13:32248140-32248162 CTTTGGGGGTTCATGAGTCATGG - Intronic
1107879148 13:44817820-44817842 GTTCAGGGCTGCTTGTGACATGG - Intergenic
1109973643 13:69802715-69802737 CTATGGGGGTGCACGTGAGAGGG - Intronic
1109982575 13:69927878-69927900 ATTTGGGGGTGTATGTGCCTGGG - Intronic
1110864894 13:80382606-80382628 GTTTGGAGCTGCATATTACATGG + Intergenic
1113002218 13:105654231-105654253 GTTTGGGAGTGCAGGTGATGTGG + Intergenic
1114547265 14:23512199-23512221 GTTGGGGGCTGGAGGTGACAGGG + Intergenic
1118191262 14:63582754-63582776 TTTTGTGTGTGTATGTGACAAGG - Intergenic
1122199058 14:100111026-100111048 GATTGTGGGGGCAGGTGACAGGG + Intronic
1123018433 14:105386491-105386513 CTTTGGGGGTGCCTGGGACTTGG - Intronic
1125428723 15:39575558-39575580 GATTGGGGCTGCACGTGACGAGG + Intergenic
1126055582 15:44726856-44726878 GTTTGGGGTTGCATGTGTTATGG - Intergenic
1126927186 15:53602751-53602773 CTTTGAGGGTGCATGTGTCCAGG - Intronic
1133705453 16:8350368-8350390 GTTTGGGGCTGCTGTTGACATGG - Intergenic
1133724914 16:8528417-8528439 GTTTGGGGGAGCAGGTCAGAAGG - Intergenic
1137365302 16:47854652-47854674 GTTGGGGGGTGCATGTGTATTGG - Intergenic
1138414638 16:56864713-56864735 CTAAGGGGGTGCATGTGAGAGGG - Intergenic
1141111740 16:81275881-81275903 GTGTGGGGGTGCCTGAGGCAGGG + Intronic
1143269172 17:5663020-5663042 GTGTGTGAGTGCATGTCACATGG - Intergenic
1143743417 17:8971541-8971563 GTTGGGGCTTGCATGTCACATGG - Intergenic
1145302226 17:21648717-21648739 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1145306853 17:21680147-21680169 GTTTGGGGCGGCATGGGAGACGG + Intergenic
1145348087 17:22054599-22054621 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1145385505 17:22409186-22409208 GTTTCGGGGCGCCTGTGACAAGG - Intergenic
1145415493 17:22710787-22710809 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1146182805 17:30708586-30708608 GTTGGGGGGTAGATGCGACATGG - Intergenic
1146675247 17:34768845-34768867 GTGTGGTGGTGCAGGTGAGAGGG - Intergenic
1151914571 17:77108073-77108095 GTATGGGGGGGCATGGAACAGGG - Intronic
1152860963 17:82697136-82697158 GTTTGGGGGAGCAGCTGAGATGG - Intronic
1153317212 18:3735979-3736001 GTGTGTGTGTGCATGTGGCATGG - Intronic
1153763743 18:8355546-8355568 ATTTGGGTGTGGAAGTGACAAGG + Intronic
1155674377 18:28411827-28411849 GTTTGTGGTTGAGTGTGACATGG - Intergenic
1156460278 18:37317874-37317896 GTGTGTGGGTGGATGTGACCGGG + Intronic
1156628509 18:38939458-38939480 GTGTGTGTGTGTATGTGACAGGG + Intergenic
1157110059 18:44812193-44812215 GTGGGGGTGTGCATGTGCCATGG - Intronic
1158503223 18:58022292-58022314 GTATGGGGGTGTATGTGGCATGG + Intergenic
1159015772 18:63100727-63100749 GTTTGGGGATGCAGCTGTCAGGG - Intergenic
1161117064 19:2503553-2503575 GTTGGTGGGTGTATGAGACAGGG + Intergenic
1161178608 19:2864188-2864210 GTTTGGGAGTGGGTGTGAGATGG + Intergenic
1162976011 19:14207219-14207241 GTTGGGGGGTAGATGCGACATGG + Intergenic
1163105134 19:15118967-15118989 GTTTGGGGATGGTTGTTACAGGG + Intronic
1164329869 19:24244041-24244063 GTTTGGGGGTGATTGGGACTTGG + Intergenic
1164885768 19:31777230-31777252 GCATGGGGGTGCTTGTGACTGGG + Intergenic
1165068344 19:33241511-33241533 GTTGGGGGGTGCATGTGGTCCGG + Intergenic
1165098584 19:33424568-33424590 GTGTGGTGGTGCATGTGTGATGG + Intronic
1166287081 19:41837814-41837836 GATTGGGGTTGCAAGGGACAGGG - Intronic
1167333025 19:48867974-48867996 GTTTGGGGGTGCATGTGGGAGGG - Intronic
1167968948 19:53173938-53173960 GTTTGTGGGTGTGGGTGACAAGG - Intronic
928470839 2:31574022-31574044 GTTTGATTGTGCATGGGACAGGG - Intronic
930563814 2:52994808-52994830 GTTTGGGGGTACATGTGAAGGGG - Intergenic
931255012 2:60563355-60563377 GTTTGGGGGTGTATGGGAAGGGG - Intergenic
936143213 2:109959138-109959160 GTTGGGGTCTGCATGTGACCTGG + Intergenic
936179902 2:110257104-110257126 GTTGGGGTCTGCATGTGACCTGG + Intergenic
936201474 2:110412329-110412351 GTTGGGGTCTGCATGTGACCTGG - Intronic
937293270 2:120794684-120794706 GTGTGGTGGTGCCTGTGACCAGG + Intronic
938555088 2:132416798-132416820 GTTTGGGAGTGTATGTGGCTGGG - Exonic
942095871 2:172536046-172536068 GTTTGGGGATACATGTGAATGGG - Intergenic
942735699 2:179109994-179110016 TTTTGGGAGTCCAAGTGACATGG - Exonic
944418014 2:199498108-199498130 TTGTGTGTGTGCATGTGACAGGG + Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
948145007 2:235702150-235702172 GGCTGGGGGTGAACGTGACACGG + Intronic
1171491792 20:25524596-25524618 TTTTCAGGGTGCGTGTGACAGGG + Intronic
1171518810 20:25760145-25760167 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1171533719 20:25868358-25868380 GTTTGGGGCGGCATGGGAGAGGG + Intergenic
1172658034 20:36548893-36548915 GTGTGGGGGTGCACGTGAAGGGG - Intronic
1173008919 20:39163520-39163542 TTTTGGGGTTGCATGTGGCAGGG + Intergenic
1173014428 20:39212029-39212051 GATTGGGGGTGGAGGTGAGAGGG + Intergenic
1175723189 20:61299974-61299996 GTTTGGGGCTGGATCTCACAAGG + Intronic
1175932789 20:62500830-62500852 GTTTGTGTGTGCAGGTGAGAGGG + Intergenic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176597145 21:8757932-8757954 ATGTGGGAGTGCATGTGAAACGG - Intergenic
1176652958 21:9566552-9566574 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1176680273 21:9815650-9815672 GTTTGGGGTGGCATGGGAGAGGG + Intergenic
1176680555 21:9817059-9817081 GTTTGGGGTGGCATGGGAGAGGG + Intergenic
1176681125 21:9819871-9819893 GTTTGGGGTGGCATGGGAGAGGG + Intergenic
1179121085 21:38546522-38546544 GTTTGTGGGCGCTTGTGTCAAGG - Intronic
1179798423 21:43799051-43799073 CTGTGGGGCAGCATGTGACAAGG - Intronic
1182063704 22:27415896-27415918 GTGTGTGTGTGCATGTGAAAAGG - Intergenic
1182201068 22:28570661-28570683 GATTGGGGGTACATGTTACATGG - Intronic
1183281720 22:36935927-36935949 GTGTGGGGATGCCTGGGACAGGG + Intronic
1185192764 22:49449006-49449028 GTGTGTGTGTGTATGTGACAGGG - Intronic
951023837 3:17809746-17809768 ATGTGAGGGAGCATGTGACAAGG + Intronic
951132545 3:19065227-19065249 GGTTGGGGGCTCATGTGACAAGG - Intergenic
952498028 3:33933169-33933191 GTTTGGGGGTGCAAGAGACAAGG + Intergenic
953434618 3:42868556-42868578 GTTGGGTGGAGCATGGGACATGG + Intronic
953951538 3:47194366-47194388 GTTTGGGGCTGATTGTTACAGGG + Intergenic
954274880 3:49535674-49535696 GGTTGGGGGCTCATGTGACGGGG + Intergenic
954642541 3:52109992-52110014 GTTTTGGGGGGCAGATGACATGG - Intronic
961106944 3:124250309-124250331 GTGTGGGGGTTCCTGTGAGAGGG + Intronic
961416871 3:126765679-126765701 ATTGGTGAGTGCATGTGACAAGG + Intronic
962746696 3:138402227-138402249 GTTTGTGGGTGCCTGTGGCCCGG - Exonic
963723459 3:148891471-148891493 GTGTGTGTGTGTATGTGACAGGG - Intronic
964725242 3:159807743-159807765 CTTTGCTGGTGCATGAGACAGGG + Intronic
964958694 3:162395019-162395041 GTTTGGAGAGGCATGTGAGAGGG + Intergenic
968661112 4:1799212-1799234 GTTTGGGGGTGCCTGCCTCATGG + Intronic
970352523 4:15217311-15217333 GGTTGGGGGAGCATGTCACAGGG + Intergenic
972491455 4:39591479-39591501 GTTTTGGGGTGCTGGTGACAAGG - Intronic
972500064 4:39669688-39669710 GTTTGTGTGTGAATGAGACAGGG + Intergenic
974401258 4:61410787-61410809 GTTTGGGGGAGCTTGGGGCAAGG - Intronic
976065784 4:81185727-81185749 GTTTGTGTTTGCATGTGAGATGG - Intronic
976938215 4:90666040-90666062 ATTGAGGGGGGCATGTGACAAGG - Intronic
978075703 4:104527077-104527099 GTTCAGGGGTACATGTGCCATGG + Intergenic
978450395 4:108827105-108827127 GTGGGGAGGTGCATGTGACCAGG + Intronic
981807194 4:148730660-148730682 GTGTAGGGCTTCATGTGACAAGG - Intergenic
986588453 5:9343879-9343901 TTTTGGGGGTACACGTGGCATGG - Intronic
996835502 5:127787324-127787346 GCCTGGAGTTGCATGTGACATGG + Intergenic
998524729 5:142831990-142832012 ATTTGGGGGTGGATATGATATGG - Intronic
998738299 5:145168583-145168605 ATTTGGAGGTGAATGTGAAAAGG + Intergenic
1000574858 5:162965118-162965140 GTGTGGTGGTGCATGTCACCAGG - Intergenic
1000666335 5:164002436-164002458 GTTTGGAGTTGAAAGTGACAAGG - Intergenic
1001465051 5:171956955-171956977 TTTTGGGGGTGGATGGGAAAGGG - Intronic
1002689587 5:181041059-181041081 GTTTGGGAGAGCAAGAGACATGG + Intronic
1007925243 6:45644752-45644774 GCTTGGTGGTCCATGTGACAGGG - Intronic
1008078511 6:47170689-47170711 GTTTGGGGGCGCTACTGACATGG + Intergenic
1008537093 6:52514671-52514693 GTTTGGGGGTGAAGTTGAAAGGG + Intronic
1012379126 6:98599235-98599257 TTTTGGGGGTGCAGGTGGAAGGG - Intergenic
1015574186 6:134653353-134653375 ATTTGGGGGTGAATGGGACTGGG + Intergenic
1018637729 6:165879079-165879101 ATTTGGGGGTGCAACTGACCTGG + Intronic
1019036443 6:169063554-169063576 GTTTGGAGGTGCAAATGATAGGG + Intergenic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1024076871 7:45825531-45825553 GTGTGGGGTGGCAGGTGACAGGG - Intergenic
1024117305 7:46206327-46206349 GTGTGAGGGTGAATGTGACATGG - Intergenic
1025127548 7:56355892-56355914 GTGTGGGGTGGCAGGTGACAGGG + Intergenic
1025279298 7:57615273-57615295 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1025284991 7:57653775-57653797 GTTTGGGGCTGCGTGAGAGAGGG + Intergenic
1025305433 7:57850227-57850249 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1025602779 7:63015450-63015472 GTGTGGGGTGGCAGGTGACAGGG + Intergenic
1025807575 7:64849755-64849777 TTTTGGGGTTGCATGAGAGATGG - Intergenic
1026527222 7:71164699-71164721 GTGTGTGTGTGCATGTGACAAGG + Intronic
1029205689 7:98868253-98868275 GTTTGGGAGTCCATGTGACATGG + Intronic
1029485718 7:100838989-100839011 CTAAGGGGGTGCATGTGAGAGGG - Intronic
1030293550 7:107896294-107896316 GTTTGGAGGTGGATCTGAGAAGG + Intronic
1034730499 7:153382995-153383017 GTTTGGCGGTGCTTCTGACTTGG - Intergenic
1034939565 7:155221466-155221488 GTTTGGGTGTGGCTGTGCCAGGG - Intergenic
1035112622 7:156495932-156495954 GTTTGTGGGTTCCTTTGACATGG - Intergenic
1036746570 8:11414167-11414189 CTTTTTGCGTGCATGTGACAAGG + Intronic
1042972115 8:74420866-74420888 GTTCTGGGGTACATGTGCCATGG + Intronic
1043198511 8:77331191-77331213 GTTTGGGGTAGAATGGGACAAGG - Intergenic
1043345077 8:79288674-79288696 CTTTGGTGCTGCATGTGACTCGG - Intergenic
1044280092 8:90344311-90344333 GTCTGTGGGAGCATGTGACTTGG + Intergenic
1044564058 8:93644889-93644911 ATTTGGGGGTGTTTGAGACAGGG + Intergenic
1044799628 8:95940738-95940760 ATTTGGAGGTGCATCTAACAGGG + Intergenic
1044879312 8:96706445-96706467 GGTTGGGGGTGAATGTGTTAAGG + Intronic
1047780596 8:128107709-128107731 GTTTGGGGGTGAAAGGTACACGG - Intergenic
1048256859 8:132911456-132911478 GTTTAGGAGTGAATGTTACATGG + Exonic
1050616132 9:7403509-7403531 GTGTCTGTGTGCATGTGACATGG - Intergenic
1051790768 9:20799735-20799757 GTTTGTCTGTGCATGTGAGATGG + Intronic
1051955436 9:22687493-22687515 GTTTAGGGGTGCAGGGTACAAGG - Intergenic
1056696056 9:88854336-88854358 GGATGTGGGTGCATGGGACATGG - Intergenic
1056822003 9:89849115-89849137 GAGTGTGAGTGCATGTGACATGG + Intergenic
1059106468 9:111515995-111516017 GTTTGAGGGTGGTTGTGAGAGGG - Intergenic
1060140174 9:121202494-121202516 CTTTGGGGTTGCCTTTGACAGGG + Intronic
1061238492 9:129355754-129355776 GTTTGGGGTGGCTTGTCACATGG - Intergenic
1203378637 Un_KI270435v1:5913-5935 GTTGGGGAGTGCATGTGTCAAGG + Intergenic
1203630687 Un_KI270750v1:70093-70115 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1203665436 Un_KI270754v1:18182-18204 GTTTGGGGCGGCATGGGAGAGGG + Intergenic
1203666006 Un_KI270754v1:21002-21024 GTTTGGGGCGGCATGGGAGAGGG + Intergenic
1203666582 Un_KI270754v1:23818-23840 GTTTGGGGTGGCATGGGAGAGGG + Intergenic
1203667152 Un_KI270754v1:26641-26663 GTTTGGGGCGGCATGGGAGAGGG + Intergenic
1203667731 Un_KI270754v1:29457-29479 GTTTGGGGTGGCATGGGAGAGGG + Intergenic
1203668300 Un_KI270754v1:32280-32302 GTTTGGGGCGGCATGGGAGAGGG + Intergenic
1203668876 Un_KI270754v1:35099-35121 GTTTGGGGCGGCATGGGAGAGGG + Intergenic
1203669723 Un_KI270754v1:39322-39344 GTTTGGGGTGGCATGGGAGAGGG + Intergenic
1186457593 X:9722211-9722233 GTTTGGGTTGGCCTGTGACAAGG - Intergenic
1187644371 X:21330568-21330590 GTGTGTTGTTGCATGTGACATGG - Intergenic
1190251391 X:48729273-48729295 CTTTGTGGGTGTATGTGCCAAGG - Intergenic
1190548921 X:51558714-51558736 GTTTTGGGATGCATTTGAAAGGG + Intergenic
1191850496 X:65582470-65582492 GTTTGGGGGTGAGGGTGAGAAGG + Intergenic
1193812412 X:86067288-86067310 GTTGGGGGGTGGAGGAGACATGG - Intergenic
1197893559 X:131288536-131288558 GTTTAGGGGTCCAAGTGGCAAGG - Intronic
1199531403 X:148851770-148851792 GTTTGGGGGTGCATGTGACACGG + Intronic
1199684963 X:150257604-150257626 CCCTTGGGGTGCATGTGACAGGG - Intergenic
1200149184 X:153943078-153943100 GTCTGGGGGTGCAGGAGGCAAGG + Exonic
1201073279 Y:10169225-10169247 CTTTGGGGGTGCATTTCATAGGG - Intergenic
1201147768 Y:11074326-11074348 GTTTGAGGGTGTATGTGTAATGG - Intergenic