ID: 1199532136

View in Genome Browser
Species Human (GRCh38)
Location X:148861784-148861806
Sequence ATGTATTTTCAGATGTGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199532136_1199532140 1 Left 1199532136 X:148861784-148861806 CCCCGCCACATCTGAAAATACAT 0: 1
1: 0
2: 0
3: 14
4: 358
Right 1199532140 X:148861808-148861830 TTAAATCAAATATCCCTTATAGG 0: 1
1: 0
2: 6
3: 33
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199532136 Original CRISPR ATGTATTTTCAGATGTGGCG GGG (reversed) Intronic
900112864 1:1015933-1015955 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
900965917 1:5958520-5958542 TTGTATTTTCAGTTGAGACGGGG - Intronic
901017654 1:6241270-6241292 AGGTATTTTCAGAGCTGGAGGGG - Intergenic
901101232 1:6720685-6720707 ATGTATTTTCAGTAGAGACGGGG + Intergenic
901390339 1:8941621-8941643 TTGTATTTTCAGAAGAGACGGGG + Intergenic
902372433 1:16014945-16014967 ATCTATATACAGATGTGGCATGG + Exonic
903116419 1:21182139-21182161 TTGTATTTTCAGAAGCGACGGGG + Intergenic
904124564 1:28228397-28228419 ATTTAATTTCAGATGTGAAGGGG - Intronic
904354358 1:29929261-29929283 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
905364598 1:37443198-37443220 AGGGATTTTCAGGTGTGGGGAGG - Intergenic
905762451 1:40571440-40571462 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
907167117 1:52422749-52422771 TTGTATTTTTAGTAGTGGCGGGG - Intronic
908058084 1:60314058-60314080 TTGTATTTTCAGTTGAGACGGGG + Intergenic
908839148 1:68261129-68261151 TTGTATTTTCAGTTGAGACGAGG + Intergenic
908855130 1:68418230-68418252 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
909459261 1:75891624-75891646 TTGTATTTTTAGCTGTGACGGGG + Intronic
909613180 1:77575009-77575031 TTGTATTTTCAGTAGAGGCGGGG - Intronic
910255365 1:85242200-85242222 TTGTATTTTCAGTAGTGACGGGG + Intergenic
910892086 1:92029101-92029123 ATGGATTTTCAGATGTGAAAGGG + Intergenic
911703712 1:100986235-100986257 TTGTATTTTTAGAAGAGGCGGGG - Intergenic
913028417 1:114871338-114871360 TTGTATTTTCAGTAGTGACGGGG + Intronic
914262196 1:146008665-146008687 TTGTATTTTCAGTTGAGACGAGG - Intergenic
914691977 1:150037760-150037782 TTGTATTTTCAGCTGAGACGGGG + Intergenic
914834862 1:151198663-151198685 TTTTTTTTTCAGATGTGGCTTGG + Exonic
915248184 1:154570592-154570614 ATGTATTTGATGATGTGGTGGGG + Intronic
916218879 1:162422996-162423018 TTGTATTTTCAGTTGAGACGGGG - Intergenic
916403259 1:164471520-164471542 ATTAATTTTCAGATGAGGCAGGG - Intergenic
916931303 1:169580554-169580576 TTGTATTTTCAGTAGAGGCGGGG + Intronic
919450402 1:197765960-197765982 ATGTACTTTTATATGTGGCTTGG - Intronic
922124444 1:222709135-222709157 ATGTATTTTCAACTGTAGCCGGG + Intronic
1063731307 10:8700178-8700200 ATGTATTTTCAGTAGAGACGGGG - Intergenic
1064097645 10:12435739-12435761 AGGTATTTTCAGAGGTGACAGGG + Intronic
1064398484 10:15000853-15000875 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1065523764 10:26597036-26597058 TTGTATTTTCAGGAGAGGCGGGG + Intergenic
1065604035 10:27397543-27397565 TTGTATTTTCAGTAGTGTCGAGG + Intergenic
1065914667 10:30343857-30343879 CTGTATTTTCAGGCTTGGCGTGG - Intronic
1066115552 10:32236193-32236215 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1070041259 10:72782542-72782564 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1070248172 10:74751070-74751092 ATGGCATTTCAGATGTGGAGAGG - Intergenic
1070587441 10:77777220-77777242 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1071325689 10:84514538-84514560 ATGAATTTTCTGACGTGGAGAGG - Exonic
1071578757 10:86751229-86751251 ATGTATTCCTAGATGTGGTGTGG - Intergenic
1072109499 10:92305231-92305253 TTGTATTTTCAGAAGAGACGGGG - Intronic
1072290697 10:93961811-93961833 TTTTTTTTTCAGATGTGGCTTGG - Intergenic
1072464047 10:95646795-95646817 ATGTGTGTACAGATGTGGCATGG + Intronic
1073032740 10:100540554-100540576 TTGGATTTTCAGATGTGGAGAGG + Intronic
1073494116 10:103876137-103876159 CTGTATTTTCCAATGTGGCCAGG + Intergenic
1073521844 10:104138501-104138523 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1073813225 10:107174501-107174523 ATGTATTGAAAGATGTGGCCGGG - Intergenic
1075949136 10:126462327-126462349 ATGCATTTTCAGAACTGGGGTGG - Intronic
1077991914 11:7419722-7419744 TTGTATTTTTAGTTGAGGCGGGG - Intronic
1079121759 11:17690352-17690374 ATGTATTTTAAGAAGTGATGGGG + Intergenic
1081899215 11:46613653-46613675 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1081918719 11:46752506-46752528 ATATATTTTCAGGTGTGACTTGG + Intronic
1082220686 11:49632103-49632125 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1082692299 11:56321428-56321450 TTGTATTTTTAGAAGAGGCGGGG + Intergenic
1083352838 11:62043326-62043348 TTGTATTTTCAGTTGAGACGGGG + Intergenic
1084896669 11:72276390-72276412 TTGTATTTTCAGCAGAGGCGGGG - Intergenic
1085009143 11:73124581-73124603 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1085286148 11:75362981-75363003 ATGTATTTTAAGAAATGGGGTGG + Intergenic
1086000191 11:81974423-81974445 TTGTATTTTCAGTTGAGACGGGG + Intergenic
1086603485 11:88664617-88664639 TTGTATTTTTAGTTGTGACGGGG + Intronic
1087351372 11:97037023-97037045 AAGTATTTGCAAATGTGGTGTGG - Intergenic
1088027608 11:105205237-105205259 TTGTATTTTCAGTGGAGGCGGGG + Intergenic
1088330178 11:108643151-108643173 TTGTATTTTCAGAAGAGGCGAGG - Intergenic
1088683033 11:112260699-112260721 ATGTATATTCAGAAGGGGCAGGG - Exonic
1090590485 11:128261757-128261779 ATGTATTTTCAGAAGTCGTCTGG - Intergenic
1091361284 11:134980413-134980435 ATGCATTTTCAGATGAGAAGTGG + Intergenic
1092468043 12:8752377-8752399 TTGTATTTTTAGTTGAGGCGAGG - Intronic
1093655593 12:21690435-21690457 ATGTATATTCAGTTGTTGCTGGG - Intronic
1093701669 12:22228879-22228901 TTGTATTTTTAGATGAGACGGGG - Intronic
1094595833 12:31865634-31865656 TTGTATTTTTAGAAGAGGCGGGG - Intergenic
1094788993 12:33887910-33887932 TTGTATTTTCAGTAGTGACGAGG - Intergenic
1095467450 12:42502690-42502712 ATGTATTTTCAGAGCAGACGCGG + Intronic
1095720057 12:45390946-45390968 TTGTATTTTCAGTAGTGACGGGG - Intronic
1096576005 12:52553282-52553304 ATGTTGTTTCAGAGGTGGAGAGG - Intergenic
1096702565 12:53395166-53395188 TTGTATTTTCAGTTGAGACGAGG - Intronic
1096739600 12:53682902-53682924 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1097161923 12:57052557-57052579 AGCTATTTTCAGATATGGTGAGG + Intergenic
1097709909 12:62906956-62906978 GTGAAGTTTCAGATGTGGAGAGG + Intronic
1097835264 12:64266524-64266546 CTGTAATTCCAGAAGTGGCGTGG + Exonic
1101108944 12:101466999-101467021 TTGTATTTTTAGTAGTGGCGGGG + Intergenic
1101115023 12:101523467-101523489 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1101767332 12:107714128-107714150 TTGTATTTTTAGTTGAGGCGGGG - Intergenic
1102641822 12:114373629-114373651 TTGTATTTTTAGAAGAGGCGGGG + Intronic
1102715468 12:114967986-114968008 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1102886567 12:116526387-116526409 TTGTATTTTTAGTTGTGGCAGGG - Intergenic
1103221326 12:119248251-119248273 TTGTATTTTCAGTGGAGGCGAGG - Intergenic
1103404057 12:120662531-120662553 TTGTATTTTCAGTTGAGACGGGG + Intronic
1103751888 12:123169771-123169793 TTGTATTTTTAGAAGTGACGGGG + Intronic
1104310532 12:127650827-127650849 ATGTATTCTCAGATGTCTGGAGG + Intergenic
1104852056 12:131881322-131881344 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1106014253 13:25853214-25853236 AGGTATTTTTAGAAGAGGCGGGG - Intronic
1106297056 13:28424109-28424131 TTGTATTTTAAGTAGTGGCGGGG + Intronic
1106316111 13:28595462-28595484 TTGTATTTTCAGTTGAGACGGGG + Intergenic
1106455766 13:29925213-29925235 TTTTATTTTCAGCTGTGGGGTGG - Intergenic
1107545841 13:41433006-41433028 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1108848046 13:54698861-54698883 TTGTATTTTCAGTAGAGGCGAGG - Intergenic
1109498490 13:63207786-63207808 TTGTATTTTCAGAAGAGACGGGG - Intergenic
1110800257 13:79685801-79685823 TTGTATTTTTAGAAGAGGCGGGG + Intergenic
1110972284 13:81780263-81780285 ATGTATTATGGGATGTGGAGAGG - Intergenic
1114312359 14:21478658-21478680 ATTTATTTTCAAAAGTGGTGTGG + Intronic
1114752666 14:25223124-25223146 TTGTATTTTCAGAAGAGGCAGGG - Intergenic
1115311053 14:31978737-31978759 ATGTATTTTCAGTTGTTGTGTGG + Intergenic
1115490487 14:33953302-33953324 TTGTATTTTTAGTTGAGGCGGGG - Intronic
1115625791 14:35190676-35190698 ATGTATTTTTAGTAGAGGCGGGG + Intronic
1116078648 14:40145188-40145210 TTGTATTTTTAGAAGAGGCGGGG + Intergenic
1116270746 14:42762234-42762256 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1116856975 14:49961172-49961194 CTGTATTTTCAGAGAAGGCGGGG + Intergenic
1117125738 14:52623170-52623192 ATGAATGTACAGATGTGGCAGGG - Intronic
1117518044 14:56522212-56522234 TTGTATTTTTAGAAGAGGCGGGG + Intronic
1117702314 14:58426377-58426399 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1119504964 14:75164593-75164615 TTGTATTTTTAGAAGAGGCGGGG + Intronic
1119987498 14:79154588-79154610 AGGTATTTTGATATGTGGCTTGG + Intronic
1122038124 14:98962995-98963017 TTGTATTTTCAGTAGTGACGGGG - Intergenic
1122908208 14:104812616-104812638 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1123680161 15:22757348-22757370 TTGTATTTTCAGTAGTGACGGGG - Intergenic
1124497884 15:30197595-30197617 ATGAATTTCAAGATGTGGCCTGG - Intergenic
1125569241 15:40702688-40702710 TTGTATTTTCAGTTGAGACGGGG + Intronic
1125737707 15:41939625-41939647 TTGTATTTTTAGAAGTGACGGGG - Intronic
1126839529 15:52703597-52703619 ATGTATTTTCAGATGTTTGGAGG - Intronic
1129416563 15:75386198-75386220 TTGTATTTTCAGAAGAGACGGGG + Intronic
1130880281 15:88049038-88049060 ATATATTTTAAGATCTGGTGAGG + Intronic
1131171585 15:90182846-90182868 ATGTATTTTCAGTAGAGACGGGG + Intronic
1132644206 16:991375-991397 ATGAGTGTTCAGATGTGGAGGGG + Intergenic
1134136693 16:11681192-11681214 ATGTGTTTTCAGTTGTTGTGGGG - Intronic
1135350047 16:21721203-21721225 ATGTGTTTTCAGAATGGGCGTGG - Intronic
1135355097 16:21762424-21762446 GTGTATTTTCAGAGGTCACGTGG + Intergenic
1135453581 16:22578566-22578588 GTGTATTTTCAGAGGTCACGTGG + Intergenic
1135696986 16:24597051-24597073 ATGTATTTTCAGTAGAGACGGGG + Intergenic
1137452247 16:48587694-48587716 ATGTAATTCCAGATATGGCCTGG - Intronic
1138471211 16:57238370-57238392 ATGTATTTTAAGATGTGGTATGG - Intronic
1140156781 16:72437428-72437450 TTGTATTTTTAGCAGTGGCGGGG - Intergenic
1140553584 16:75894293-75894315 TTGTATTTTCAGTAGTGGCGGGG + Intergenic
1141107038 16:81242371-81242393 TTGTATTTTCAGTAGTGACGGGG + Intronic
1142770330 17:2092156-2092178 ATGTATTTTCAGTAGAGACGGGG + Intronic
1142818302 17:2445611-2445633 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1143028826 17:3956052-3956074 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1143155031 17:4831152-4831174 TTGTATTTTCAGTTGAGACGGGG - Intergenic
1144774003 17:17775173-17775195 ATGAATTTTCAGCTGTGTGGGGG - Intronic
1147007669 17:37417205-37417227 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1147131122 17:38409769-38409791 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1147151272 17:38515920-38515942 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1148977064 17:51538910-51538932 TTGTATTTTCACATGGGGTGGGG + Intergenic
1149643149 17:58218272-58218294 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1149676669 17:58470751-58470773 ATGTATTTTTAGTAGTGACGGGG - Intronic
1150322466 17:64227051-64227073 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1150463576 17:65372790-65372812 TTGTATTTTTAGTTGAGGCGGGG + Intergenic
1150649215 17:66998990-66999012 ATGTAGTTTGAGAGGTGGTGGGG + Intronic
1151577393 17:74959636-74959658 ATGTCATTTCAGAGGTGGTGGGG - Intronic
1151611185 17:75176441-75176463 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1152095966 17:78271773-78271795 ATGTATCTGCAAATGAGGCGGGG + Intergenic
1152313046 17:79562601-79562623 GTGTATTTTCAGAAGCTGCGGGG - Intergenic
1153838523 18:8985889-8985911 ATGTATTTTCAGTAGAGACGAGG - Intergenic
1155110590 18:22710384-22710406 CTGTCTTTTCAGATGTGTCAGGG + Intergenic
1155513782 18:26603568-26603590 TTGTATTTTTAGTTGAGGCGGGG - Intronic
1155586643 18:27374237-27374259 ATGTATTTGCAGTTGTGTGGTGG - Intergenic
1155912069 18:31515557-31515579 ATGTATTTTCAAAGGTGGCATGG - Intronic
1157859080 18:51124845-51124867 TTGTATTTTCAGTAGTGACGGGG - Intergenic
1157885404 18:51361605-51361627 TTCTATTTTTAGATGTGGCCTGG - Intergenic
1158433077 18:57409244-57409266 TTGTATTTTCAGTAGTGACGGGG - Intergenic
1158810175 18:61022965-61022987 AGGTATTTTCAGATGTAACTGGG + Intergenic
1158854052 18:61524746-61524768 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1158975970 18:62712028-62712050 TTGTATTTTCAGTGGAGGCGGGG + Intergenic
1161314286 19:3610759-3610781 AACTATTTCCAGATGAGGCGGGG + Exonic
1161468582 19:4445397-4445419 AAGTATTTCCAGAGGTGGCTTGG + Exonic
1161499489 19:4605938-4605960 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1161517275 19:4703450-4703472 TTGTATTTTTAGTTGTGACGAGG - Intronic
1161555667 19:4941261-4941283 TTGTATTTTCAGTGGAGGCGGGG + Intronic
1162096960 19:8315975-8315997 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1162274641 19:9643179-9643201 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1164236323 19:23338877-23338899 TTGTATTTTCAGAAGAGACGGGG - Intronic
1164612152 19:29639833-29639855 TTGTATTTTCAGTAGTGACGAGG - Intergenic
1165892599 19:39123206-39123228 TTGTATTTTCAGTTGAGACGGGG - Intergenic
1166206069 19:41270153-41270175 TTGTATTTTCAGTAGTGACGGGG + Intronic
1167212900 19:48144674-48144696 TTGTATTTTCAGAAGAGACGAGG + Intronic
925974305 2:9130522-9130544 TTGTATTTTTAGAAGAGGCGGGG + Intergenic
926512182 2:13795524-13795546 TTGTATTTTTAGTTGAGGCGGGG + Intergenic
930164654 2:48192495-48192517 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
930192256 2:48472065-48472087 TTGTATTTTTAGAAGAGGCGGGG - Intronic
930672260 2:54163680-54163702 TTGTATTTTTAGTAGTGGCGGGG - Intronic
932241796 2:70163038-70163060 TTGTATTTTTAGTTGTGACGGGG + Intronic
932252951 2:70259986-70260008 TTGTATTTTCAGTAGTGACGGGG + Intronic
933548623 2:83745185-83745207 ATGTATATTTGGAGGTGGCGGGG + Intergenic
933755841 2:85637866-85637888 TTGTATTTTTAGTTGTGACGGGG + Intronic
936720106 2:115241094-115241116 TTGTATTTTTAGTAGTGGCGGGG - Intronic
938154921 2:128927373-128927395 ATGTAGTTTCATATGCGGCATGG - Intergenic
938831670 2:135056008-135056030 TTGTATTTTTAGTAGTGGCGGGG + Intronic
938988037 2:136598705-136598727 ATGTATATTCTGATTTGGGGTGG - Intergenic
939781365 2:146452688-146452710 ATGTACTTTCAGATTGGGCTTGG - Intergenic
940871173 2:158861537-158861559 TTGTATTTTCAGTAGAGGCGGGG + Intronic
941028452 2:160484695-160484717 TTGTATTTTCAGTAGAGGCGGGG - Intronic
941078442 2:161032909-161032931 TTGTATTTTCAGAAGAGACGGGG - Intergenic
941146958 2:161859772-161859794 TTGTATTTTTAGAAGTGACGGGG + Intronic
941470833 2:165884970-165884992 TTGTATTTTCAGTTGAGGCGAGG - Intronic
942261545 2:174170057-174170079 ATGTATTTTTAGTAGTGACGGGG - Intronic
944697230 2:202212976-202212998 TTGTATTTTTAGTAGTGGCGGGG - Intronic
945560922 2:211338931-211338953 AGGTATTTTCTGAAGTTGCGAGG - Intergenic
1170175675 20:13466570-13466592 ATGTATTTTTAGTGGTGACGGGG - Intronic
1170942722 20:20862641-20862663 ATGGGATTTCAGAGGTGGCGTGG + Intergenic
1170982445 20:21227178-21227200 AGGTAATTTCAGATTTGGGGGGG - Intronic
1174017441 20:47500260-47500282 ATGTATTTTTAGTAGTGACGGGG + Intergenic
1174477224 20:50804209-50804231 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1177122259 21:17152661-17152683 ATGTATTTTCAGTTGTTCTGGGG + Intergenic
1177838282 21:26209766-26209788 ATGTATATTCAGGTGGGGCATGG - Intergenic
1179585565 21:42371999-42372021 ACTTATTTTCACATGTGGGGAGG - Exonic
1180111023 21:45650902-45650924 ACCTAATTTCAGATGGGGCGGGG + Intronic
1182461050 22:30484412-30484434 TTGTATTTTTAGTAGTGGCGGGG + Intergenic
1182648396 22:31829357-31829379 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1182888110 22:33793294-33793316 ATCTTTTATCAGATGTGGGGTGG - Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
949148193 3:730309-730331 TTGTATTTTCAGTAGAGGCGAGG - Intergenic
949926347 3:9045338-9045360 ATGCATTTTCAGAAGTAGAGGGG - Intronic
950857326 3:16118294-16118316 TTGTATTTTCAGTGGAGGCGGGG + Intergenic
951500685 3:23383693-23383715 ATATATTTTCAGATATTGCCAGG - Intronic
952033304 3:29170679-29170701 AGGGATTTTCAGATGAGGGGAGG + Intergenic
952294382 3:32048477-32048499 TTGTATTTTCAGTAGAGGCGGGG + Intronic
953329633 3:42042097-42042119 TTGTATTTTCAGTAGTGACGGGG + Intronic
954843537 3:53534201-53534223 AGTTATTTCCAGAAGTGGCGTGG + Intronic
955140518 3:56264422-56264444 TTGTATTTTCAGTAGAGGCGGGG - Intronic
955451900 3:59077497-59077519 ATGTATTTTTAGAAGAGACGGGG - Intergenic
956070575 3:65445859-65445881 ATGTAATTCCAGATGTGACAAGG - Intronic
956826701 3:73003870-73003892 TTGTATTTTCAGTTGAGACGGGG + Intronic
959166932 3:102792178-102792200 ATTTATTTTCAGATATGTCCAGG - Intergenic
959895331 3:111599140-111599162 TTGTATTTTTAGATGAGTCGGGG + Intronic
961136067 3:124512475-124512497 TTGTATTTTCAGTAGTGGCAGGG - Intronic
962266321 3:133946940-133946962 TTGTATTTTTAGTTGAGGCGGGG - Intronic
962804999 3:138920724-138920746 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
963424038 3:145100590-145100612 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
963659312 3:148104122-148104144 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
963715339 3:148796325-148796347 TTGTATTTTTAGTAGTGGCGGGG - Intronic
965851313 3:173029010-173029032 ATGTAATATCAGATGAGGCCAGG + Intronic
966138933 3:176732922-176732944 ATGTATTTTCATATGCAGAGTGG + Intergenic
966546647 3:181156947-181156969 TTGTATTTTCAGTAGAGGCGAGG + Intergenic
966930995 3:184675458-184675480 TTGTATTTTCAGTAGAGGCGGGG + Intronic
967830827 3:193918714-193918736 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
968033707 3:195526953-195526975 ATGTATTTTCAGTAGAGACGGGG + Intronic
968183718 3:196616374-196616396 TTGTATTTTCAGGTGAGACGGGG + Intergenic
970279283 4:14436295-14436317 TTGTATTTTCAGTAGAGGCGAGG - Intergenic
971494198 4:27246759-27246781 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
972333812 4:38087667-38087689 CTGTATTTTCAGTTGAGACGGGG - Intronic
974282731 4:59820264-59820286 GTGTATTTTCAGTTGAGACGGGG + Intergenic
975475451 4:74817899-74817921 ATACATTTTGAGATCTGGCGTGG - Intergenic
975684989 4:76910891-76910913 AATTATTTTCAGATATGGCTAGG - Intergenic
976199355 4:82563068-82563090 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
976295969 4:83472731-83472753 ATGTATTTTAGGAGGTGGCTGGG + Intronic
976473277 4:85454386-85454408 TTGTATTTTTAGTTGAGGCGGGG - Intergenic
978678737 4:111352045-111352067 TTGTATTTTGAGAAGAGGCGGGG - Intergenic
979237037 4:118412528-118412550 TTGTATTTTCAGTTGAGACGGGG - Intergenic
979254139 4:118594228-118594250 TTGTATTTTCAGTTGAGGCAGGG - Intergenic
979827999 4:125264201-125264223 TTGTATTTTCAGTAGTGACGGGG - Intergenic
980095811 4:128489527-128489549 TTGTATTTTCAGTTGAGACGAGG + Intergenic
981308363 4:143269906-143269928 ATGTATTTTTAGTAGAGGCGGGG + Intergenic
981326610 4:143455673-143455695 CTGAATTTACAGATGTGGCTTGG - Intronic
982235831 4:153250290-153250312 ATGTATTTTTAGTAGTGACGGGG + Intronic
982512495 4:156300640-156300662 TTGTATTTTCAGAAGAGACGGGG - Intergenic
983234858 4:165167642-165167664 TTGTATTTTTAGATTTGGCAAGG - Intronic
983920023 4:173334733-173334755 AAGTATTTTTAAATCTGGCGGGG - Exonic
984398457 4:179230003-179230025 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
984427772 4:179609536-179609558 CTGTATTTTCAGTTGAGACGAGG - Intergenic
985423123 4:189803927-189803949 ATGATTATTCAGATGTGGTGAGG + Intergenic
985786887 5:1900624-1900646 ATGAATATGCAGATGTGGAGAGG - Intergenic
986391158 5:7289332-7289354 TTGTATTTTCAGTAGTGACGGGG - Intergenic
986729419 5:10624300-10624322 TTGTATTTTCAGCAGAGGCGGGG + Intronic
987332354 5:16868428-16868450 ATGTATTTTTAGTAGAGGCGGGG - Intronic
988351682 5:30116814-30116836 ATGCATTTTCTGGTGTGGAGGGG - Intergenic
988356838 5:30187597-30187619 ATGTATTATCTGATGTGGTTTGG + Intergenic
988508064 5:31841498-31841520 TTGTATTTTCAGTTGAGACGGGG - Intronic
989050742 5:37317314-37317336 TTGTATTTTCAGAAGAGACGGGG - Intronic
990725766 5:58753194-58753216 ATTTATTTTTAAATGTGTCGAGG + Intronic
990806091 5:59663896-59663918 ATATATTTTGAGATGAGACGAGG - Intronic
991904810 5:71498894-71498916 TTGTATTTTCAGTTGAGACGAGG + Intronic
992553687 5:77883284-77883306 TTGTATTTTCAGTAGAGGCGAGG + Intergenic
992793657 5:80236696-80236718 TTGTATTTTCAGTAGAGGCGGGG + Intronic
993687004 5:90950122-90950144 ATGCAGTTTAAGATGTGGCATGG - Intronic
995604524 5:113837689-113837711 TTGTATTTTTAGATGAGACGGGG - Intergenic
996737920 5:126774803-126774825 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
996761041 5:126985782-126985804 ATGAATTTTTAGAGGTGGTGGGG + Intronic
997557363 5:134812235-134812257 TTGTATTTTTAGTTGAGGCGGGG + Intronic
998050661 5:139030487-139030509 ATGTATTTTTTGGTGTGGCATGG + Intronic
998094389 5:139389042-139389064 TTGTATTTTCAGTAGTGACGGGG + Intronic
999601110 5:153266427-153266449 ATGTATTATCAGGTGGGGCGCGG + Intergenic
1000325833 5:160171335-160171357 TTGTATTTTCAGTAGTGACGGGG + Intergenic
1001890649 5:175335381-175335403 ATGTATTTTCAGTAGAGACGGGG - Intergenic
1002714144 5:181215897-181215919 ATATATTTAGAGATGTGGAGGGG + Intergenic
1002777579 6:341911-341933 TTGTATTTTGAGATGTGGCAAGG + Intronic
1003651660 6:7966694-7966716 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1003922797 6:10849214-10849236 TTGTATTTTTAGTTGTGACGAGG - Intronic
1006111441 6:31748519-31748541 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1006776402 6:36596095-36596117 TTGTATTTTTAGTTGTGACGGGG + Intronic
1007400281 6:41599189-41599211 AGGCAGTTTCAGATGTGGGGAGG - Exonic
1007433388 6:41789465-41789487 ATGTGTTTTCAGATGTTGAAAGG + Intronic
1008285126 6:49640181-49640203 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1009728288 6:67562686-67562708 TTGTATTTTTAGGTGAGGCGGGG - Intergenic
1009889823 6:69667018-69667040 TTGTATTTTTAGAAGAGGCGGGG - Intergenic
1011010627 6:82699694-82699716 ATATGTTTTAAGATGTAGCGAGG + Intergenic
1011665035 6:89625108-89625130 TTGTATTTTTAGAAGAGGCGGGG - Intronic
1011891120 6:92161130-92161152 GTATACTTTCAAATGTGGCGTGG + Intergenic
1011905674 6:92364358-92364380 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1013116110 6:107104998-107105020 ATGAACCTGCAGATGTGGCGGGG + Intronic
1013791282 6:113839849-113839871 ATGTATTTTGATATCTGGCATGG - Intergenic
1016237269 6:141883226-141883248 TTGTATTTTCAGTTGGGGCAGGG - Intergenic
1017290889 6:152734716-152734738 AGGTATTTGCATAAGTGGCGTGG + Intergenic
1018264489 6:162007961-162007983 ATATATTTTCAGATGTCGCTAGG + Intronic
1018393307 6:163357615-163357637 TTGTATTTTCAGTGGAGGCGGGG - Intergenic
1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG + Intronic
1019653818 7:2176173-2176195 TTGTATTTTCAGTAGTGACGAGG - Intronic
1020557549 7:9690025-9690047 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1021898129 7:25256886-25256908 ATGTATTTTCAGATGTCTTTGGG - Intergenic
1022019449 7:26384089-26384111 TTGTATTTTCAGTAGAGGCGAGG + Intergenic
1025616592 7:63123716-63123738 ATGTATTTTTAGTTGAGGCGAGG + Intergenic
1027518856 7:79178537-79178559 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1028575369 7:92343652-92343674 ATGTATTTTGAGATGGGGTCTGG - Intronic
1029080262 7:97967816-97967838 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1029135610 7:98368516-98368538 ATGTATTTTTAGTAGAGGCGGGG - Intronic
1030328644 7:108249174-108249196 ATATATTTTGAAATGTGGCTGGG - Intronic
1030699080 7:112619076-112619098 TTGTATTTTCAGTAGTGACGGGG - Intergenic
1032396541 7:131594029-131594051 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1033756369 7:144400708-144400730 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1033901295 7:146144161-146144183 ATTTATTTTGAGATGGGGCCTGG + Intronic
1036433727 8:8713651-8713673 TTGTATTTTCAGTAGTGACGGGG - Intergenic
1037124477 8:15330020-15330042 ATGCATTTTCAGATGTTGGGCGG - Intergenic
1039709595 8:40042455-40042477 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1041216236 8:55603921-55603943 ATATATTTTCTGCTGTGACGTGG + Intergenic
1041282049 8:56220142-56220164 TTGTATTTTCAGTAGTGACGGGG + Intergenic
1042893545 8:73640742-73640764 ATGTATTTCTAGATGAGGCAGGG - Intronic
1044128874 8:88495303-88495325 TTGTATTTTCAGTAGTGACGGGG - Intergenic
1044567983 8:93685617-93685639 TTGTATTTTCAGTTGAGACGGGG + Intergenic
1044857361 8:96490343-96490365 ATCTATTTTCAGGCCTGGCGCGG - Intergenic
1050073301 9:1838935-1838957 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1050523837 9:6528447-6528469 ATGGGTTTTCAGATGGGGCCAGG + Intergenic
1050971426 9:11880961-11880983 ATGTATTTTTAGATATTGCCAGG + Intergenic
1051698316 9:19792172-19792194 ATGTTATTTCAGATGGGGCAAGG - Intergenic
1051780413 9:20683545-20683567 ATGTATTTTCTCGTGGGGCGGGG - Intronic
1052759008 9:32570368-32570390 ATGCATTTTGGGAAGTGGCGTGG - Intronic
1052796146 9:32925219-32925241 ATATATTTCCAGGTGTGGTGAGG + Intergenic
1052951162 9:34213336-34213358 TTGTATTTTTAGATGAGACGGGG - Intronic
1053051682 9:34966588-34966610 ATTTATTTTGAGATGGGGCGAGG - Intronic
1053062692 9:35044234-35044256 ATGTAGCTTCTGATGTAGCGAGG - Exonic
1055017381 9:71633481-71633503 TTGTATTTTCAGTGGTGACGGGG - Intergenic
1055288493 9:74757003-74757025 TTGTATTTTCAGTTTTGGCCAGG - Intronic
1055322910 9:75099653-75099675 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1055963443 9:81842623-81842645 TTGTATTTTTAGTAGTGGCGGGG + Intergenic
1056343184 9:85659447-85659469 ATGTATTTTCAGATGACACATGG - Intronic
1056428728 9:86505512-86505534 TTGTATTTTCAGAAGAGACGGGG - Intergenic
1056748536 9:89326986-89327008 TTGTATTTTCAGTTGAGACGGGG - Intronic
1057284526 9:93740422-93740444 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1057952403 9:99380104-99380126 TTGTATTTTTAGTTGAGGCGGGG + Intergenic
1058054998 9:100440432-100440454 ATGTAATTTCAGATGTGAAAGGG - Intronic
1058339751 9:103879767-103879789 TTGTATTTTCAGTAGAGGCGGGG + Intergenic
1058359693 9:104129623-104129645 ATCTATTTTTATATGTGGCTAGG + Exonic
1058479069 9:105372460-105372482 TTGTATTTTCAGTTGAGACGGGG + Intronic
1059556438 9:115285280-115285302 TTGTATTTTCAGTTGAGACGGGG + Intronic
1060162177 9:121374094-121374116 TTGTATTTTCAGTAGAGGCGGGG - Intergenic
1060624886 9:125102768-125102790 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1061473838 9:130849439-130849461 ATGTATCTGCAGATTTGGCAAGG + Intronic
1061688591 9:132305178-132305200 TTGTATTTTCAGTAATGGCGGGG - Intronic
1185460326 X:330325-330347 TTGTATTTTCAGTTGAGACGGGG - Intergenic
1185816894 X:3164471-3164493 ATGGAATTCCAGATGTGGAGCGG - Intergenic
1187922527 X:24219107-24219129 GTGTATTTTTAGTAGTGGCGGGG - Intergenic
1189826106 X:44919780-44919802 ATGTATTTTCAGTAGAGACGGGG + Intronic
1190289026 X:48979784-48979806 TTGTATTTTCAGTTGAGACGGGG + Intronic
1192122916 X:68474080-68474102 TTGTATTTTCAGTTGAGACGGGG + Intergenic
1194530455 X:95042010-95042032 ATGTATTTTCATCAGTGGCTAGG - Intergenic
1195927117 X:110037448-110037470 TTGTGTTTTCTGATGTGGCTGGG - Intronic
1197242036 X:124130287-124130309 TTGTATTTTCAGTAGAGGCGGGG - Intronic
1197830580 X:130638238-130638260 TTGTATTTTCAGTAGAGGCGGGG + Intronic
1198981610 X:142403839-142403861 TTGTATTTTTAGATGAGACGGGG - Intergenic
1199532136 X:148861784-148861806 ATGTATTTTCAGATGTGGCGGGG - Intronic
1200958231 Y:8972276-8972298 ATGGATTTGCAGATGAGGCTGGG - Intergenic
1201012793 Y:9565073-9565095 TTGTATTTTCAGTAGTGACGTGG + Intergenic
1201486250 Y:14497652-14497674 TTGTATTTTCAGTAGAGGCGAGG - Intergenic