ID: 1199535756

View in Genome Browser
Species Human (GRCh38)
Location X:148901123-148901145
Sequence ATGAAGAAACTGATGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2085
Summary {0: 1, 1: 9, 2: 86, 3: 434, 4: 1555}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199535755_1199535756 21 Left 1199535755 X:148901079-148901101 CCGTTGCTGTAGAAAAGGCAGGA 0: 1
1: 0
2: 0
3: 20
4: 225
Right 1199535756 X:148901123-148901145 ATGAAGAAACTGATGCTCAAAGG 0: 1
1: 9
2: 86
3: 434
4: 1555
1199535753_1199535756 24 Left 1199535753 X:148901076-148901098 CCACCGTTGCTGTAGAAAAGGCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1199535756 X:148901123-148901145 ATGAAGAAACTGATGCTCAAAGG 0: 1
1: 9
2: 86
3: 434
4: 1555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199535756 Original CRISPR ATGAAGAAACTGATGCTCAA AGG Intronic
Too many off-targets to display for this crispr