ID: 1199538574

View in Genome Browser
Species Human (GRCh38)
Location X:148931771-148931793
Sequence CTAGTTCAGAACACCATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199538574 Original CRISPR CTAGTTCAGAACACCATTAT GGG Intronic
903912693 1:26739449-26739471 CCAGTTCAGAAGACCACAATTGG + Intronic
906461470 1:46037730-46037752 CTAGTTCAGACCACCAAAATGGG - Intergenic
906898760 1:49809392-49809414 GTTGTCCAGAACACCATTTTTGG - Intronic
906957995 1:50392832-50392854 CTAATTCAAAATAACATTATAGG + Intergenic
911153250 1:94615504-94615526 CTAGGTCAGAAAACCACTGTGGG + Intergenic
914321494 1:146566527-146566549 CTGGTTCAGAAAAACATTAATGG - Intergenic
916233713 1:162564364-162564386 GTAGTTCAGAGCACAATTCTAGG - Intronic
918023203 1:180715573-180715595 ATAGTTCAGAAGAAGATTATAGG + Intronic
924093303 1:240524775-240524797 GTAGTTCAGAAAACCATGGTAGG - Intronic
1068547805 10:58370854-58370876 ATCGGTCAGAACACCATTTTGGG + Intergenic
1072465708 10:95660487-95660509 CTGGTTCAGGACTCCATTCTTGG + Intergenic
1074486024 10:113881163-113881185 CTAATTCAATACACCATTAGAGG - Intronic
1074785391 10:116834755-116834777 CTTGTTCAGAACACCAGCAAGGG - Intergenic
1075852016 10:125596962-125596984 CTACTTCAAAAAGCCATTATGGG + Intronic
1080087339 11:28300067-28300089 CTAGGTCAGATCACATTTATAGG + Intronic
1080868909 11:36219419-36219441 GTAGTTAACAACACCCTTATTGG + Intronic
1081589124 11:44408695-44408717 CTAGTTCAAAACTCCTTTCTGGG + Intergenic
1085277853 11:75311616-75311638 GCAGTTAATAACACCATTATGGG - Intronic
1092821635 12:12358391-12358413 CTAGTTCAGACCTACATTCTGGG + Intronic
1097655500 12:62357059-62357081 CTAGTTTAGAAAACCAATCTTGG + Intronic
1098263943 12:68699692-68699714 CTCATTCAGAACACCACAATGGG - Intronic
1101796479 12:107979512-107979534 CTGGTTGAAAACACCAGTATGGG + Intergenic
1108067338 13:46591749-46591771 TTTGTTCAAAACACCATTATTGG - Intronic
1109823414 13:67686478-67686500 CTAGATCAGATAACCAGTATAGG - Intergenic
1112961255 13:105129834-105129856 TAAGTACAAAACACCATTATAGG + Intergenic
1114201659 14:20526505-20526527 CTAGTAGAGGACACCATTAGAGG - Intergenic
1115529745 14:34316357-34316379 CTATTTCCTAACCCCATTATGGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128687526 15:69697846-69697868 CAAATTAAGAACAGCATTATGGG - Intergenic
1129081337 15:73043694-73043716 CTAGTTCAGCACTCCAGTGTTGG + Intergenic
1136407965 16:30059936-30059958 CTAGTTCATAAGGCCATTGTCGG - Intronic
1140012134 16:71144616-71144638 CTGGTTCAGAAAAACATTAATGG + Intronic
1147750759 17:42731416-42731438 TTGGTTCAGAAAAGCATTATGGG - Intronic
1148546270 17:48521506-48521528 TCATTTCAGAACACCATTTTTGG + Intergenic
1164778746 19:30875416-30875438 CTAGTCCAGAAGACCAGCATTGG + Intergenic
926939784 2:18123210-18123232 CTAGACCAGAACAGCATAATTGG - Intronic
927462856 2:23313913-23313935 CTACTTCATCACACCAATATCGG + Intergenic
931682672 2:64765058-64765080 CTAGTACAGAAAGCCATTGTAGG + Intergenic
943254186 2:185572743-185572765 TTAGTTAAGAACATTATTATAGG + Intergenic
944390807 2:199217524-199217546 CTATTTCAAAAGACCATTATGGG - Intergenic
945430828 2:209762694-209762716 CTAGTTCCTGACACCATTTTAGG - Intergenic
945798399 2:214392839-214392861 CTAATTTAGAACACAATTCTAGG - Intronic
1185040600 22:48501870-48501892 CTGTTTCAGAAGACCATTCTGGG - Intronic
951779792 3:26349501-26349523 CTAAGTCAGAAAGCCATTATGGG - Intergenic
955444591 3:58996137-58996159 CTAGGTAACAACACCATAATTGG + Intronic
955571976 3:60317753-60317775 CTAGTTCAAAATTCCATTCTGGG + Intronic
956244794 3:67170701-67170723 CTTTTTCAGAACTCCAATATTGG - Intergenic
957570719 3:81945001-81945023 CTTGTTCAGAACCCCAGGATGGG - Intergenic
963328579 3:143889479-143889501 CTATTTCAGAAACCTATTATTGG - Intergenic
965740522 3:171869621-171869643 CTATTTCCAAAGACCATTATGGG + Intronic
965892163 3:173527984-173528006 CTAGCTAACAACACTATTATAGG - Intronic
970937897 4:21596282-21596304 ATATTTCAGTACACCATAATTGG + Intronic
973184785 4:47313096-47313118 TTAGGTCAGAACACTATAATGGG - Intronic
977799973 4:101216393-101216415 ATAATTCATAACACCATGATTGG - Intronic
987873539 5:23650039-23650061 CTAGTTAAGATCACCTTTGTAGG + Intergenic
989661388 5:43802145-43802167 GCACTTCAGAGCACCATTATGGG - Intergenic
993893346 5:93501652-93501674 CTATTTCAGAAAACCACTTTTGG - Intergenic
998886780 5:146702800-146702822 CTAGTTAAGAGCATCAGTATTGG - Intronic
1000146990 5:158462999-158463021 CTAGTACAAAGCACCATTCTAGG + Intergenic
1004734971 6:18396480-18396502 CTAGGTCAGAACAACAGGATTGG + Intronic
1008868206 6:56240637-56240659 TTAGTTAAAAGCACCATTATAGG - Intronic
1009498809 6:64384929-64384951 CCAGTTCAGAAAGACATTATTGG + Intronic
1010127643 6:72451588-72451610 CTAGTTCAGAAGAGCCTTTTTGG + Intergenic
1010127700 6:72452599-72452621 CTAGTTCAGAAGAGCCTTTTTGG + Intergenic
1010471133 6:76229922-76229944 ATAGTTCAGAGAACCATTGTGGG + Intergenic
1011420039 6:87161872-87161894 CTAGTTCTGGAAACCATTAGGGG - Intronic
1011955418 6:93019341-93019363 CTAGTTAAGAACACTATGACAGG + Intergenic
1013050166 6:106525643-106525665 CTAGTCCAAAACAATATTATGGG - Intronic
1014411000 6:121120709-121120731 CTAGTTCAGAGAACAGTTATAGG + Intronic
1014663433 6:124202942-124202964 CTAATTTAGCACAACATTATAGG + Intronic
1015488296 6:133796829-133796851 CAATTTCAAAACTCCATTATTGG + Intergenic
1015837749 6:137439878-137439900 CTAGTTCAGGACACAATAAAGGG - Intergenic
1023256149 7:38314522-38314544 ATAGTGCAGATGACCATTATAGG - Intergenic
1030123675 7:106134625-106134647 GTATTTCATAACACCACTATAGG + Intergenic
1030359744 7:108582382-108582404 CTAGACCAGACCACCATTCTGGG - Intergenic
1031325077 7:120385720-120385742 CTAGTTCAAGACAACATTAAAGG + Intronic
1032738718 7:134717196-134717218 TTAGTTCATAATAGCATTATTGG - Intergenic
1033965655 7:146971817-146971839 GTAGTTCAAAACTCCATGATGGG - Intronic
1035762315 8:2078035-2078057 CTAGTTCAGAAAATCAGTGTTGG - Intronic
1037926459 8:22847433-22847455 GAAATTCAGAACACCATCATGGG + Intronic
1040131374 8:43800899-43800921 CTGGTTGAGAACACCCTTTTTGG + Intergenic
1047989308 8:130269020-130269042 CTTGTACATAAAACCATTATTGG + Intronic
1048106869 8:131420514-131420536 GTAGTTCAGAAGTCCATCATGGG - Intergenic
1050110471 9:2210167-2210189 CTAGTACAGAAAACCCTTAGGGG - Intergenic
1052547460 9:29898559-29898581 CAAGGTCAAAACACCATTTTTGG + Intergenic
1056449552 9:86703002-86703024 GTATTTCAGAGCACCATTGTGGG + Intergenic
1059296577 9:113276016-113276038 CTATTTCAGAGCACCGTTACTGG - Intronic
1061751225 9:132778386-132778408 CTAGTTCAGGCCTCCATTAATGG + Intronic
1186566306 X:10666627-10666649 CTAGTTCTGAGCACAATTAAAGG + Intronic
1187632341 X:21187831-21187853 CAAGTTCAGAAGAAAATTATAGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1199068086 X:143443929-143443951 CTAGTCCAGAATATAATTATAGG + Intergenic
1199538574 X:148931771-148931793 CTAGTTCAGAACACCATTATGGG + Intronic