ID: 1199538920

View in Genome Browser
Species Human (GRCh38)
Location X:148936192-148936214
Sequence TCATTATCACAGAAAACGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 569}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199538920_1199538924 14 Left 1199538920 X:148936192-148936214 CCTTGCGTTTTCTGTGATAATGA 0: 1
1: 0
2: 2
3: 43
4: 569
Right 1199538924 X:148936229-148936251 AGATTCCAATATGCCTTCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199538920 Original CRISPR TCATTATCACAGAAAACGCA AGG (reversed) Intronic
900839692 1:5038333-5038355 TCACTATCACAGGAACAGCATGG + Intergenic
900869598 1:5292655-5292677 TCACTATCACAAAAAGAGCATGG + Intergenic
901165242 1:7216210-7216232 TCACTATCACAAAAACAGCAAGG + Intronic
902297826 1:15480643-15480665 TCAGTATCACAAAAATAGCATGG + Intronic
902962299 1:19973052-19973074 TCATTGCCACAGAGAACGTATGG - Intergenic
904057255 1:27679616-27679638 TCACTATCACAAGAAAAGCAGGG + Intergenic
904374942 1:30074685-30074707 TCACTATCACAAGAAAAGCATGG - Intergenic
905373820 1:37504089-37504111 TCACTATCACAGGAATAGCATGG - Intronic
907259543 1:53207033-53207055 TCACTATCACAAGAAAAGCATGG - Intronic
907356550 1:53879722-53879744 TCATTATAAAGGAAAACGGATGG + Intronic
907582629 1:55585618-55585640 TCATTATCACAAGAACAGCAAGG + Intergenic
907721462 1:56976128-56976150 TCACTATCACAAGAAAAGCATGG - Intergenic
908112457 1:60910771-60910793 TCACTATCACAAGAAAAGCATGG - Intronic
908337721 1:63144589-63144611 TCACTATCACAAAAACAGCATGG - Intergenic
908476236 1:64491534-64491556 TCACTATCACAAGAAAAGCAGGG + Intronic
908846849 1:68333609-68333631 TGATTATCAGAGACAATGCAGGG + Intergenic
909592974 1:77372590-77372612 TCTTGATCAAAGAAAACACAAGG - Intronic
909862208 1:80622015-80622037 TCACTATCACAGTAACAGCATGG + Intergenic
910052564 1:82992808-82992830 TCACTATCACAAAAACAGCAAGG - Intergenic
911317315 1:96370739-96370761 TCTTTATCATGGAAAATGCAAGG - Intergenic
911606810 1:99915399-99915421 TCTTTACTACAGAAAAAGCATGG + Exonic
911824943 1:102470896-102470918 TCACTATCACAGGAACAGCATGG + Intergenic
911956686 1:104244478-104244500 TCATTATAACAAAAACAGCATGG - Intergenic
912109919 1:106329180-106329202 TCATTATCACAATAATAGCATGG + Intergenic
912263432 1:108131538-108131560 TCACTATCACAAGAAAAGCATGG + Intergenic
912660627 1:111526322-111526344 TCATTATCACAAGAATAGCATGG - Intronic
912994738 1:114521584-114521606 TCCTTATCTCTGAAAACACAGGG + Intergenic
913091625 1:115480111-115480133 TCATTATCACAAGAACAGCATGG + Intergenic
917433665 1:174997975-174997997 TCTTTATCTCTGAAAACACAGGG - Intergenic
918155814 1:181845547-181845569 GCATTATAACAGAGAAAGCATGG - Intergenic
918699976 1:187596711-187596733 TCATTATCACAGGAATAGCATGG + Intergenic
918737640 1:188086558-188086580 TTATTATCACAGGAACAGCATGG + Intergenic
918845307 1:189602071-189602093 TGATTATCACAGAATCCACAAGG + Intergenic
921225370 1:213014543-213014565 TTATTAGCATAGAAAATGCATGG - Intronic
921453810 1:215342483-215342505 TCACTATCACAAAAACAGCATGG + Intergenic
921936799 1:220803267-220803289 TCACTATCACAAAAAAAGCATGG + Intronic
922394111 1:225178420-225178442 TCACTATCACAGGAATAGCAAGG + Intronic
923283692 1:232469682-232469704 TCTTTATCACAGAAAAAATAAGG + Intronic
923977913 1:239285582-239285604 TCATTATCACAAGAACAGCATGG + Intergenic
924167799 1:241303227-241303249 TCATTATCACAAGAACAGCAAGG - Intronic
1063136848 10:3224685-3224707 TTATTATCACAAGAAAAGCAGGG - Intergenic
1063845834 10:10125872-10125894 TCACTATCACAAAAATAGCATGG + Intergenic
1063851786 10:10200550-10200572 TCCTTATCTCTGAAAACACAGGG + Intergenic
1064282280 10:13961670-13961692 TCAACATCACAGAAAAGGCAAGG + Intronic
1064628032 10:17281664-17281686 TCATTATCACAAGAACAGCATGG - Intergenic
1064858613 10:19799359-19799381 TCACTATCACAAAAACAGCAAGG + Intergenic
1065398432 10:25267398-25267420 TCATTATCACAAGAAAAGGATGG + Intronic
1065438619 10:25726697-25726719 TCACTATCACAGGAACAGCATGG - Intergenic
1065682090 10:28246725-28246747 TCACTATCACAAAAAGAGCATGG + Intronic
1066484715 10:35832349-35832371 TCATTATCACAAGAACAGCAAGG + Intergenic
1068454752 10:57239439-57239461 TCATTATCACAAAAACAACATGG - Intergenic
1068559395 10:58496399-58496421 TCACTATCACAAGAAAAGCATGG - Intergenic
1068682153 10:59831780-59831802 CCATTATCACAGAGAACTCTGGG - Intronic
1069209305 10:65735792-65735814 CCATTGACACAGAAAATGCATGG - Intergenic
1070502576 10:77085394-77085416 TCATTAGCACATCAAACTCATGG - Intronic
1070521519 10:77257719-77257741 TCACTATCACAGGAACAGCATGG - Intronic
1071163431 10:82778520-82778542 TCATTATCATGAAAAAAGCATGG + Intronic
1071927746 10:90430272-90430294 TCATTATCACAAAAACAGCATGG - Intergenic
1073688888 10:105785737-105785759 TCACTATCACGAAAAAAGCACGG - Intergenic
1073929397 10:108556370-108556392 TCATTATCACAGGAACAGGATGG - Intergenic
1075506484 10:123027437-123027459 TCATTATCACAAGAATAGCACGG - Intronic
1075959889 10:126559276-126559298 TCATTATAACAGAGCATGCATGG - Intronic
1078328173 11:10397375-10397397 TCATTATCACAAGAACAGCATGG + Intronic
1079181812 11:18200695-18200717 TCACTATCACAAGAAAAGCACGG + Intronic
1079546698 11:21642061-21642083 TCATTATCACAAGAACAGCATGG - Intergenic
1079585764 11:22125527-22125549 TCACTATCACAAGAAAAGCATGG - Intergenic
1079820600 11:25122586-25122608 TCATTTTCACAGGAACAGCATGG + Intergenic
1079880714 11:25923045-25923067 TCACTATCACAAGAAAAGCATGG + Intergenic
1079958511 11:26893867-26893889 TCACTATCACAAAAACAGCATGG + Intergenic
1080163850 11:29213170-29213192 TCACTATCACAAAAACAGCATGG + Intergenic
1080312506 11:30911511-30911533 TCATTATTACAGAGCATGCATGG - Intronic
1080740077 11:35055696-35055718 TCATTATCACAAGAACAGCATGG - Intergenic
1080959732 11:37144970-37144992 TCATTATCACAGTAACAGCACGG + Intergenic
1081141496 11:39506522-39506544 TCACTATCACTGAAACCACATGG + Intergenic
1081175839 11:39925237-39925259 TCACTATCACAGGAACAGCATGG - Intergenic
1081440462 11:43075578-43075600 TCATTATCACAAGAACAGCATGG + Intergenic
1084679411 11:70657638-70657660 TGATTATCACAGATAACCCAAGG - Intronic
1086053229 11:82618452-82618474 TCATTATCACAAGAACAGCAAGG - Intergenic
1086848542 11:91782254-91782276 TCATTATCACAAAAATGGCAGGG + Intergenic
1087385378 11:97462917-97462939 TCACTATCACAAAAACAGCATGG - Intergenic
1087917137 11:103823809-103823831 TCATTATCACAAGAACAGCATGG - Intergenic
1088021838 11:105129766-105129788 TCATTATCACAAGAACAGCATGG + Intergenic
1093208804 12:16283118-16283140 TCACTGTCACAGGAAAGGCAAGG - Intergenic
1093798914 12:23347880-23347902 TCCTTATCTCAGAAGACACAAGG - Intergenic
1094043038 12:26137375-26137397 TCATTATGCCAGAAAGAGCATGG + Intronic
1095382671 12:41614500-41614522 TCACTATCACAGGAACAGCACGG - Intergenic
1095523690 12:43098895-43098917 TCATGCTAAAAGAAAACGCAAGG - Intergenic
1095619470 12:44231987-44232009 TCATTTTTACAGAAGAGGCATGG - Intronic
1096544783 12:52330422-52330444 TCATTATCACAAAAACAGCATGG - Intergenic
1096740630 12:53691360-53691382 TCATTATCACAAGAACAGCATGG - Intergenic
1096751662 12:53763083-53763105 TTATGATCACAGAAATCACAAGG + Intergenic
1098976130 12:76903915-76903937 TCACTATCACAGGAACAGCATGG - Intergenic
1099110984 12:78560674-78560696 ACATTTTCACAGAATACGCAAGG + Intergenic
1099706008 12:86153632-86153654 TCATTATCACAAGAACAGCATGG - Intronic
1099937991 12:89150893-89150915 TCACTATCACAGGAATAGCATGG - Intergenic
1099975530 12:89542197-89542219 TCAATAGGACAGAAAAGGCATGG + Intergenic
1100047841 12:90405822-90405844 TCACTATCACAAAAACAGCATGG + Intergenic
1100208519 12:92377103-92377125 TCATTATTAATGAAAAGGCAGGG - Intergenic
1100446147 12:94661844-94661866 TCATTTTCACAGAAAAAACTGGG + Intergenic
1100511205 12:95276004-95276026 TCATTATCACTGAAGATTCAGGG + Intronic
1100523648 12:95400088-95400110 TCACTCTCTCAGAAAAGGCAAGG + Intergenic
1100747346 12:97660914-97660936 TCACTATCACAGGAATAGCATGG + Intergenic
1101143406 12:101818829-101818851 TCACTATCACAGGAACAGCATGG - Intronic
1101672214 12:106886170-106886192 TCAATATCACAAAAAACACAGGG - Exonic
1104493957 12:129219223-129219245 TCACTATCACAAGAAAAGCATGG - Intronic
1104542314 12:129677350-129677372 TCATGATCACGGCAAAGGCAAGG - Intronic
1105711657 13:23015501-23015523 TCATTATCACAAGAATAGCAAGG + Intergenic
1106198736 13:27517546-27517568 TCATTTACACAGAAAACTCAAGG + Intergenic
1106496731 13:30285381-30285403 TCATTATCACAAGAACAGCATGG - Intronic
1106832061 13:33594347-33594369 TCATTATGGCAGAAAAAGCTTGG - Intergenic
1107037530 13:35917002-35917024 TCATTATCGCTGAAGACACAGGG + Intronic
1107282265 13:38750285-38750307 TCATTATCACAAGAACAGCAAGG - Intronic
1107641229 13:42445817-42445839 TCACTATCACAGAAACAGCATGG - Intergenic
1108148414 13:47504320-47504342 TCAATATCCCAGAAAACTAATGG + Intergenic
1108972664 13:56396908-56396930 TCCTTGTCACATAAAAAGCAAGG - Intergenic
1109459487 13:62637212-62637234 TCATTATCACAAGAAGAGCAAGG + Intergenic
1110054248 13:70944693-70944715 TTATAGTCACAGAAAAGGCAGGG - Intergenic
1110193310 13:72756662-72756684 TCACTATCACAGGAACAGCATGG - Exonic
1111314063 13:86528832-86528854 TCACTATCACAAGAAAAGCATGG - Intergenic
1111473182 13:88712268-88712290 TCACTATCACAAAAACAGCATGG - Intergenic
1112264226 13:97908070-97908092 TCATTATCACAAGAACAGCAAGG - Intergenic
1112546861 13:100379757-100379779 TCACTATCACAGGAACCACACGG + Intronic
1112610291 13:100948701-100948723 TCATTCCCACAGAAGAAGCAGGG - Intergenic
1112851558 13:103712467-103712489 TCACTATCACAGCAACAGCAAGG + Intergenic
1113305562 13:109074726-109074748 TCACTATCACAAAAACAGCATGG + Intronic
1113346806 13:109486123-109486145 TCACTATCACAGGAACAGCAAGG - Intergenic
1114780217 14:25530863-25530885 TCATTATCATAGAATAGGTATGG + Intergenic
1115134940 14:30096522-30096544 TCACTATCACAAAAACAGCATGG - Intronic
1115964813 14:38876202-38876224 TCATTAACACAGAAAAATTATGG - Intergenic
1116267500 14:42712567-42712589 TCATTATCACAAGAACAGCATGG + Intergenic
1116646400 14:47534577-47534599 TCATTATCACAAGAATAGCATGG + Intronic
1117826140 14:59705680-59705702 TCATTAACACAGACAAGGCTGGG + Intronic
1118484362 14:66199917-66199939 TCACTATCACAAAAACAGCATGG - Intergenic
1119163431 14:72472020-72472042 TAATTATCACAAAAATCGCAGGG + Intronic
1119216716 14:72875100-72875122 TCACTATCACAAAAATAGCATGG + Intronic
1120392439 14:83925271-83925293 TCATTATCACAAAAACAGCAAGG - Intergenic
1120642932 14:87037478-87037500 TCTTTACCACAGTAAAAGCATGG - Intergenic
1120691545 14:87598718-87598740 TCATTATCACAAGAACAGCAAGG + Intergenic
1120708502 14:87769489-87769511 TCATTATCACAAGAACAGCATGG + Intergenic
1121227099 14:92328951-92328973 TCCTTATCACAGAAAGCCCCAGG - Intronic
1121932366 14:97983985-97984007 GCATTATCCTAGAAAATGCAGGG + Intergenic
1122172876 14:99891187-99891209 TTATTTTCACAGCAAACCCAAGG + Exonic
1124195391 15:27621640-27621662 ACATTTTCACAGAGAAAGCAGGG - Intergenic
1125230661 15:37451827-37451849 TCACTATCACAGGAACAGCATGG - Intergenic
1125452245 15:39821264-39821286 TCATTATAAAACAAAATGCAAGG + Intronic
1126489355 15:49219256-49219278 TCATTATCACAAGAACAGCATGG - Intronic
1126873091 15:53010545-53010567 TCATTATCACAAGAATAGCACGG + Intergenic
1128470871 15:67951380-67951402 TCACTATCACAGGAATAGCACGG - Intergenic
1128660594 15:69498121-69498143 TCTTTCTCACAGGAAAGGCAGGG - Intergenic
1129919063 15:79303127-79303149 TCATTATCAGTGAGAACACATGG - Intergenic
1131724698 15:95208172-95208194 TCACTATCACATAAACAGCATGG - Intergenic
1133386363 16:5373393-5373415 TCATTATCACAAGAAGAGCAAGG - Intergenic
1133537779 16:6718661-6718683 TCACTATCACAAAAACAGCAAGG - Intronic
1133894129 16:9909220-9909242 TCACTATCACAAGAAAAGCATGG + Intronic
1135812880 16:25605611-25605633 TCATTATCACAAGAATAGCATGG - Intergenic
1135831936 16:25782180-25782202 TCATTATCACAAGAACAGCATGG + Intronic
1136663017 16:31781558-31781580 TCACTATCACAAAAACAGCAGGG - Intronic
1137373857 16:47933739-47933761 TCATTATCACCCAAAATCCATGG + Intergenic
1137628751 16:49927235-49927257 TCATTATCATCCAAAACCCATGG - Intergenic
1137680814 16:50343276-50343298 TCATTATCACAAGAACAGCAAGG - Intronic
1137868800 16:51929736-51929758 TCATTATCACAAGAACAGCAAGG + Intergenic
1137885917 16:52103355-52103377 TCATTGTCACAAAAATGGCAAGG - Intergenic
1138047806 16:53744163-53744185 CCATTATCATAGAAACTGCAGGG + Intronic
1138362036 16:56438773-56438795 TCATTAACAAATAAAACACAAGG + Intronic
1139163087 16:64534885-64534907 TCACTATCACAGGAACAGCACGG - Intergenic
1139175674 16:64684417-64684439 TCATTATCACAAGAACAGCAGGG + Intergenic
1140200668 16:72892181-72892203 TAAGTGTCACAGAAAACTCATGG + Intronic
1140848304 16:78910758-78910780 TCACTATCACAGAAACAACATGG + Intronic
1141008933 16:80378929-80378951 TCATTATCAGAAAAACAGCATGG - Intergenic
1141533274 16:84661401-84661423 TCATTAGCAAAGAAATGGCAGGG - Intronic
1141719713 16:85749639-85749661 GGATTAAAACAGAAAACGCAGGG + Intronic
1142562684 17:820190-820212 CCATCATCACAGACAAGGCACGG - Intronic
1144997223 17:19278499-19278521 TCACTATCACAGGAATAGCATGG + Intronic
1145324984 17:21815417-21815439 TCATTCTCCCCGAAAACTCAGGG + Intergenic
1146184968 17:30718844-30718866 TCATAAGCAAATAAAACGCATGG + Intergenic
1146669025 17:34724142-34724164 TCATCATCCTGGAAAACGCACGG - Intergenic
1147405239 17:40206805-40206827 TCATTATCACGGAATCAGCAAGG + Intergenic
1147523014 17:41192574-41192596 TCTTTATCTCATAAAACACAGGG - Intronic
1149291762 17:55224703-55224725 TCATTATCAAAGAAAACTTGGGG - Intergenic
1150350453 17:64440280-64440302 TCACTATCACAAGAAAAGCATGG + Intergenic
1151997671 17:77620536-77620558 TCACTATCACAGTAACAGCATGG + Intergenic
1152998936 18:435444-435466 TCATTATCACAAGAACAGCATGG + Intronic
1156081273 18:33339688-33339710 TCATTATCACAAGAATAGCATGG - Intronic
1157951622 18:52044524-52044546 AAATTATTACAGAAAACCCATGG + Intergenic
1158056226 18:53284390-53284412 TCACTATCACAAAAACAGCACGG - Intronic
1158218639 18:55127227-55127249 TCACTATCACAGGAACAGCATGG - Intergenic
1158406699 18:57166199-57166221 TCATTATCACAAGAACAGCATGG + Intergenic
1158484707 18:57855821-57855843 TCATTTTCACAGAAAAAGGGAGG + Intergenic
1158819449 18:61142449-61142471 TCATTATCACAAGAACAGCATGG + Intergenic
1159252598 18:65899488-65899510 TCACTATCACAAAAACAGCATGG + Intergenic
1159357526 18:67357307-67357329 TCATTATCACAAGAACAGCATGG - Intergenic
1159682940 18:71377786-71377808 TAATTAACACAGAGAAAGCATGG - Intergenic
1159721513 18:71897679-71897701 TCACTATCACAAAAAGAGCATGG - Intergenic
1159757139 18:72379808-72379830 TCACTATCACAAAAACAGCATGG - Intergenic
1159824345 18:73188331-73188353 TCACTACCACAGGAAAAGCATGG - Intronic
1159841243 18:73401546-73401568 TCATTATCACAAGAACGGCATGG - Intergenic
1162254361 19:9476236-9476258 TCATTATCACGAAAACAGCATGG - Intronic
1163841836 19:19616126-19616148 TGATTATTACAGAAAAGGAAAGG - Intronic
1164165349 19:22669256-22669278 CCATTAACACAGAAAAAGAAGGG - Intergenic
1164816015 19:31204088-31204110 TCACTATCACAAGAAAAGCATGG + Intergenic
1165533900 19:36426872-36426894 TCACTATCACAAAAACAGCATGG - Intergenic
925292681 2:2758177-2758199 TCACTATCACAAAAACAGCAAGG - Intergenic
925354545 2:3228729-3228751 TCATTATCACAAGAACAGCATGG - Intronic
925524688 2:4787051-4787073 TCATTATCACAAGAACGGCATGG + Intergenic
925716520 2:6788918-6788940 TCACTATCACAAGAAAAGCATGG - Intergenic
925821054 2:7800252-7800274 TCATTATCACAAGAACAGCAAGG - Intergenic
926791191 2:16573642-16573664 TCATTATCACAAGAATAGCATGG - Intronic
927072533 2:19545761-19545783 TCACTATCACAGGAACAGCATGG + Intergenic
927292210 2:21415779-21415801 TCATTATCACGAAAACAGCATGG - Intergenic
927365730 2:22294293-22294315 TCATTATCAAAGAGAAAGCATGG + Intergenic
927586837 2:24315692-24315714 TCATTATCACAAAAACAACAAGG - Intronic
927684823 2:25163049-25163071 TTTTTATCACTGAAAACTCAAGG - Intronic
928845187 2:35663104-35663126 TCATGATGACAGAAAAAGGAAGG - Intergenic
929311804 2:40434183-40434205 TCATTATCAGAGAAAAAGGAAGG + Intronic
929850999 2:45590540-45590562 TCATTATCACAAGAACAGCATGG - Intronic
930328618 2:49953796-49953818 TTATTATTATAGAAAACACATGG + Intronic
930444431 2:51451990-51452012 TCACTATCACAAAAACAGCAAGG - Intergenic
930813060 2:55562076-55562098 TCACTATCACAAAAATAGCAAGG - Intronic
931006467 2:57855573-57855595 TCATTATCCCAAGAAAAGCATGG + Intergenic
931107315 2:59070733-59070755 TCATTATCACAGAAATCACATGG - Intergenic
931180079 2:59890847-59890869 ACACTATCACAGAAACAGCACGG + Intergenic
931683454 2:64771609-64771631 TCTTCAGCACAGAAAAGGCAGGG - Intergenic
932847439 2:75150430-75150452 TCACTATCACAAGAAAAGCATGG - Intronic
933445596 2:82376643-82376665 TCACTATCACAGGAACAGCATGG - Intergenic
933493320 2:83016576-83016598 TCATTATCACAGGGAAAGCATGG - Intergenic
935047278 2:99493590-99493612 TCATTATCACAAGAACAGCATGG + Intergenic
935487858 2:103680004-103680026 TCACTATCACAAAAACAGCAGGG - Intergenic
936257202 2:110927202-110927224 TCACTATCACAAAAACAGCAAGG + Intronic
936872347 2:117147646-117147668 TCACTATCACAAAAACAGCATGG + Intergenic
936874058 2:117167204-117167226 TCACTATCACAAAAACAGCATGG - Intergenic
937030518 2:118735504-118735526 TCATTATCACAAGAACAGCATGG + Intergenic
937176070 2:119936455-119936477 TCATTATCACAAGAACAGCATGG - Intronic
937926418 2:127171038-127171060 TCATTCTCACATTAAAAGCATGG + Intergenic
937935562 2:127241355-127241377 TCACTATCACAGGAATAGCATGG + Intergenic
939016752 2:136912659-136912681 TCATTATCACAAGAATAGCAGGG - Intronic
939439849 2:142233035-142233057 TCACTATCACAAAAACAGCAAGG - Intergenic
940408964 2:153337426-153337448 TCAGTAAGACAGAAAATGCAAGG + Intergenic
941343651 2:164339387-164339409 TTAAGATCACAGAAAACTCACGG + Intergenic
941999987 2:171636505-171636527 TCATTATCACAAGAACAGCATGG - Intergenic
942254626 2:174084381-174084403 TCACTGTCATAGAAAACACAGGG + Intronic
942380375 2:175384996-175385018 TCATTATCACAAGAACAGCATGG - Intergenic
942501902 2:176599973-176599995 TCATTATCACAAGAACAGCAGGG - Intergenic
942908101 2:181207674-181207696 TCACTATCACAGGAACAGCATGG + Intergenic
942912759 2:181265392-181265414 TCATTATCACAAGAACAGCAAGG - Intergenic
943371931 2:187026910-187026932 TCACTATCACAAAAACCGCATGG - Intergenic
943542770 2:189238766-189238788 TCACTATCACAAAAACAGCATGG + Intergenic
943933338 2:193883156-193883178 TCACTATCACAAAAACAGCATGG + Intergenic
943996054 2:194766943-194766965 TAATTACAACAGAAAACGGATGG + Intergenic
944223966 2:197331094-197331116 TCACTATCACAGGAACAGCATGG + Intergenic
945123607 2:206484852-206484874 TCATTATCACAAGAACAGCAGGG - Intronic
946142156 2:217700545-217700567 TCATTATCACAAGAAAAGCATGG - Intronic
946630652 2:221664585-221664607 TCATTATCACTGAGAATTCATGG + Intergenic
946846465 2:223863065-223863087 TCACTATCACAAAAACAGCATGG + Intronic
946937244 2:224735077-224735099 TCACTATCACAGGAACAGCAAGG - Intergenic
947297621 2:228649971-228649993 TCACTATCACAAAAAAAGCATGG - Intergenic
947443030 2:230139969-230139991 TCACTATCACAAAAACAGCAAGG - Intergenic
947907490 2:233775881-233775903 TCACTATCACACAAATAGCATGG - Intronic
948647532 2:239416511-239416533 TCACTATCACAAAAACAGCATGG - Intergenic
1169592975 20:7164956-7164978 TCATTATCACAAGAACAGCATGG - Intergenic
1169857854 20:10123385-10123407 TCACTATCACAAGAAAAGCATGG + Intergenic
1170331019 20:15210700-15210722 TCACTATCACAGGAAGAGCAAGG - Intronic
1171885567 20:30649531-30649553 TCATTATATCAGAAAACCAAGGG + Intergenic
1172811850 20:37653882-37653904 TCAGTATCACAGGAACAGCATGG + Intergenic
1173098194 20:40058788-40058810 TCACTATCACAGGAACAGCATGG + Intergenic
1173109432 20:40172607-40172629 TCATTATCACTAAAACAGCATGG + Intergenic
1173483337 20:43421035-43421057 TCACTATCACAAAAACAGCACGG - Intergenic
1174858899 20:54071586-54071608 TCATTATAAAAGAAAAGCCAAGG + Intergenic
1175017828 20:55810755-55810777 TCATTATCACAAAAATAGCATGG - Intergenic
1175195518 20:57240790-57240812 TCATTATCACCAAAACAGCATGG + Intronic
1175758060 20:61542528-61542550 TCATTATCATGGAAAACCCTAGG - Intronic
1176695862 21:9977459-9977481 TCACTATCACAGGAACAGCATGG - Intergenic
1177226079 21:18258100-18258122 TCATAATACCAGAAAACACAAGG + Intronic
1177323762 21:19556731-19556753 TCAGTATCACAAGAAAAGCATGG + Intergenic
1177347308 21:19890480-19890502 TCATTATCACAAGAACAGCATGG - Intergenic
1177655003 21:24005223-24005245 TCACTATCACAAAAACAGCATGG + Intergenic
1177686722 21:24447145-24447167 TCATTTTCACAAGAACCGCATGG + Intergenic
1177699351 21:24615817-24615839 TCATTATCACAAGAACAGCATGG - Intergenic
1178118540 21:29443153-29443175 TCATTATCACAAGAACAGCATGG - Intronic
1178295406 21:31405698-31405720 TCACTATCACAGGAACAGCACGG + Intronic
1178638785 21:34329381-34329403 TCATTATCACAAGAACAGCAAGG + Intergenic
1178668862 21:34572912-34572934 TCATTATCACAAGAATAGCAAGG + Intronic
1179226014 21:39454130-39454152 TCATTAGCACTGACATCGCAGGG - Intronic
1180723107 22:17924065-17924087 TCACTATCACAAGAAAAGCATGG + Intronic
1182912300 22:33995018-33995040 TCACTATCACACAAACAGCATGG - Intergenic
1183861881 22:40676302-40676324 TCATTATCACAAAAACAGGAAGG + Intergenic
949163549 3:910459-910481 TCATTCTCATAGAAGAAGCAAGG - Intergenic
949372426 3:3349803-3349825 TCATTATCACGGGAACAGCATGG - Intergenic
949830895 3:8212989-8213011 TCATTATCACAACAACAGCATGG - Intergenic
949908156 3:8876535-8876557 TCAATGTCACAGCAAATGCAAGG - Intronic
951153789 3:19324427-19324449 TCACTATCACAGGAACAGCAGGG + Intronic
951612487 3:24506308-24506330 ACCTTATCACAGAAAAGGAAAGG + Intergenic
951614623 3:24528200-24528222 TCATTACCACTAAAAACGCTGGG - Intergenic
951875062 3:27414961-27414983 TCATTATTATAGAAAAAGCCAGG - Intronic
953073556 3:39547221-39547243 TCATTATCACAAGAACAGCATGG - Intergenic
953188254 3:40658544-40658566 TCATTATCACAAGAACAGCATGG + Intergenic
953543660 3:43844108-43844130 TCAATATAACAGAAACCCCAAGG + Intergenic
953567063 3:44041940-44041962 TCATTCTCAGACAAAAGGCAAGG + Intergenic
954476563 3:50751923-50751945 TCATTATCACAAGACCCGCATGG + Intronic
955109075 3:55929724-55929746 TCATTATCACAAGAACAGCAAGG - Intronic
955779453 3:62468742-62468764 TCATTATAACAGAAGAGGAATGG - Intronic
956524689 3:70144703-70144725 TCATTATCACAGGAACAGCATGG - Intergenic
956684469 3:71811946-71811968 TCCTTATCACTGAAACCACAGGG - Intergenic
956919253 3:73909018-73909040 TCACTATCACAAAAACAGCATGG - Intergenic
957148594 3:76456917-76456939 TCACTATCACAAAAATAGCAGGG + Intronic
957261314 3:77905471-77905493 TCATTATCACAATAACAGCATGG - Intergenic
957301030 3:78391172-78391194 TCACTATCACAAAAACAGCATGG - Intergenic
957476913 3:80737550-80737572 TCATTATCACAAGAACAGCATGG + Intergenic
957476986 3:80738601-80738623 TCACTATCACAAAAAAAGCATGG + Intergenic
957576592 3:82015494-82015516 TCATTATCACAAGAACCACATGG - Intergenic
957737145 3:84216772-84216794 TCATTATCACAAGAATAGCATGG + Intergenic
957905201 3:86544312-86544334 TTATTAACACATAAAACTCAGGG - Intergenic
958121371 3:89293603-89293625 TCATTATCATGAGAAACGCATGG - Intronic
958266295 3:91441368-91441390 TCCTTATCACTGAAGACACAGGG + Intergenic
959364868 3:105444415-105444437 TCATTATCACAAGAACAGCATGG + Intronic
959412492 3:106042567-106042589 TCACTATCACAGGAACAGCATGG - Intergenic
959459997 3:106614021-106614043 TCACTATCACAAAAAAAGCAAGG + Intergenic
959507795 3:107175169-107175191 TCACTATCACAGAAACAGCAAGG - Intergenic
959613002 3:108315787-108315809 TCAAGATAAAAGAAAACGCAAGG - Intronic
959804852 3:110539201-110539223 TCATAATCACAAAAACAGCATGG - Intergenic
962040014 3:131697085-131697107 TCTTCATCTCAGAAAACCCAGGG - Intronic
962047433 3:131775550-131775572 TCACTATCACAAGAAAAGCATGG - Intronic
962227888 3:133631618-133631640 TCATTATCACAAGAACAGCAAGG - Intronic
962275539 3:134010796-134010818 TCACTATCACAAAAACAGCATGG + Intronic
962855672 3:139342688-139342710 TCATTTTCAGAGAAAAGGCATGG + Intronic
963134520 3:141889132-141889154 TCATTATCACAAGAACAGCAAGG + Intronic
963351768 3:144160356-144160378 TCATTATCACAAGAACAGCATGG - Intergenic
963404543 3:144845269-144845291 TCATTATCACAAGAACAGCATGG + Intergenic
964324568 3:155532553-155532575 TCACTATCACAAAAACAGCATGG - Intronic
964689991 3:159439444-159439466 TCACTATCACAAAAACAGCATGG + Intronic
964930593 3:162017139-162017161 TCATTATCACAAAAACAACATGG - Intergenic
965091729 3:164171727-164171749 TCATTATCCTGGAAAACACAGGG + Intergenic
965467834 3:169054626-169054648 TCTTTCTCTCAGAAACCGCATGG + Intergenic
967013900 3:185464442-185464464 CCATTATCACAAAAACAGCATGG - Intronic
969103482 4:4787573-4787595 TCATTATCACAAGAACAGCATGG - Intergenic
969138497 4:5050247-5050269 TAATTCTCACAGACAACCCAAGG + Intergenic
969947544 4:10799884-10799906 TCATTATCACAAGAACAGCATGG + Intergenic
970279910 4:14443651-14443673 TCATTATCACAAGAACAGCATGG - Intergenic
970351532 4:15206464-15206486 TCATTATCACAAGAATAGCATGG - Intergenic
970701802 4:18750206-18750228 TCACTATCACAGGAACAGCATGG + Intergenic
970739397 4:19216371-19216393 TCACTATCACAGGAACAGCATGG - Intergenic
970742202 4:19251461-19251483 TCATTATCACAAGAATAGCATGG - Intergenic
970812205 4:20107525-20107547 TCACTATCACAATAAAAGCATGG - Intergenic
971056845 4:22922742-22922764 TCATTATCACAAGAATAGCATGG - Intergenic
971681613 4:29707694-29707716 TCATTATCACAAGAACAGCATGG + Intergenic
971800592 4:31285377-31285399 TCAGTATCACAAGAAAAGCATGG - Intergenic
971841960 4:31864235-31864257 TCATGATCACAGAAACCAAAAGG + Intergenic
972031526 4:34465248-34465270 TCATTATCACAAGAACAGCATGG - Intergenic
972199831 4:36701696-36701718 TCACTATCACAAGAAAAGCATGG - Intergenic
972518144 4:39828981-39829003 TCTTTATCAAATAAAACCCAGGG + Intronic
972845118 4:42978881-42978903 TCACTATCACAAAAACAGCATGG - Intronic
972894544 4:43603068-43603090 TCATTATCACAAGAAAAGCATGG - Intergenic
974528760 4:63080193-63080215 TCACTATCACAAAAACAGCATGG - Intergenic
974614127 4:64259777-64259799 TCATTTTCACTGAACACTCACGG + Intergenic
974815093 4:66994158-66994180 TCATTATCATAAAAACAGCATGG + Intergenic
974832751 4:67209960-67209982 TCACTATCACAGAAACAGCATGG - Intergenic
974852734 4:67423141-67423163 TCTTTTTCACAGCAAACCCAAGG + Intergenic
974876037 4:67703892-67703914 TCATTATCACAAGAATAGCATGG + Intergenic
975279337 4:72541655-72541677 TCACTATCACAAAAACAGCATGG - Intronic
975285141 4:72607971-72607993 TCACTATCACAAAAACAGCATGG - Intergenic
976425850 4:84902289-84902311 TCATTATCACAGAAAACAAGAGG + Intronic
976427887 4:84927634-84927656 TCATTATCACAACAACAGCATGG - Intronic
976823662 4:89235216-89235238 TCATTATCACAAGAACAGCATGG - Intergenic
976937416 4:90654048-90654070 TCATTATCACAGGAACAGCAAGG + Intronic
977343344 4:95788325-95788347 TCATTATCATAGAGAAAGGAAGG - Intergenic
977395397 4:96464561-96464583 TCTTTATTTCAGAAAACACAGGG + Intergenic
978109582 4:104946821-104946843 TTATTTTCACAGAAAATGCTGGG + Intergenic
978318192 4:107463674-107463696 TCATTATCACAAGAACAGCATGG + Intergenic
978921577 4:114189842-114189864 TCACTATCACAAGAAAAGCATGG + Intergenic
979172246 4:117615825-117615847 TAATAAGCACAGAAAAGGCATGG + Intergenic
979174277 4:117642981-117643003 TCACTATCACAAAAACAGCATGG + Intergenic
979203848 4:118011089-118011111 TCATTATCACAAGAATAGCAAGG + Intergenic
979436264 4:120695802-120695824 ATATTAACACAGAAAATGCAAGG + Intronic
979556274 4:122051063-122051085 TCACTATAACAGAATAAGCAGGG + Intergenic
979806470 4:124978684-124978706 TCACTATCACAAAGAAAGCATGG - Intergenic
981021349 4:140032228-140032250 TCATTTTCAAAGACAAGGCAAGG + Intronic
981039063 4:140204960-140204982 TCATTATCACTGCAAATACATGG - Intergenic
981738562 4:147978494-147978516 TCACTATCACAGGAACAGCATGG - Intronic
981935260 4:150232838-150232860 TCATTGGAACAGAAAAAGCAGGG - Intronic
982430463 4:155316062-155316084 TCACTATCACAAAAATGGCATGG - Intergenic
982854236 4:160361640-160361662 TCACTATCACAAGAAAAGCATGG + Intergenic
982987643 4:162231516-162231538 TCATTATCACAAGAACAGCATGG + Intergenic
983146840 4:164227304-164227326 TCATTATCACAAGAACAGCATGG + Intronic
983300585 4:165920108-165920130 TGATTTTCACAGGAGACGCATGG - Intronic
983742800 4:171156151-171156173 TCACTATCACAGGAACAGCATGG + Intergenic
983766561 4:171491154-171491176 TTATTTTCACATAAAATGCAAGG - Intergenic
983825002 4:172248713-172248735 TCATTATCACAAGAATAGCATGG - Intronic
984028798 4:174577178-174577200 TCACTATCACAAAACAAGCATGG - Intergenic
984372302 4:178883206-178883228 TCACTATCACAGGAACAGCAAGG - Intergenic
984774129 4:183466049-183466071 TCACTATCACAAAAATAGCAAGG - Intergenic
986003688 5:3649965-3649987 TCACTGTCACAGAAACAGCATGG - Intergenic
986021858 5:3812082-3812104 TCACTATCACAGGAACAGCATGG + Intergenic
986160915 5:5227818-5227840 TCATTATCACAGCAAAAGACTGG + Intronic
986341700 5:6794493-6794515 TCATTATCACAAGAATAGCATGG - Intergenic
986837255 5:11652175-11652197 TCACTATCACAAAAATAGCACGG - Intronic
986892569 5:12327281-12327303 TCATTATCACAAGAACAGCATGG + Intergenic
986905047 5:12485835-12485857 TCACTATCACAGCAACAGCAAGG - Intergenic
987215367 5:15731415-15731437 TCACTATCACAGGAACAGCATGG + Intronic
987422900 5:17741804-17741826 TCACTATCACAAAAACAGCACGG + Intergenic
987433424 5:17864303-17864325 TCACTATCACAAAAACAGCATGG - Intergenic
987594902 5:19985241-19985263 TCATTATCAAAGCAAAAGGAGGG + Intronic
987659747 5:20856387-20856409 TCACTATCACAAGAAAAGCACGG - Intergenic
987699799 5:21382608-21382630 TCATTATCACAAGAATAGCAAGG + Intergenic
987741827 5:21918639-21918661 TCATTATCACAAGAACAGCATGG + Intronic
987927088 5:24355834-24355856 TCACTGTCACAAAAAAAGCATGG - Intergenic
987986028 5:25146982-25147004 TCATTATCACAAGAACGGCATGG - Intergenic
988197210 5:28019601-28019623 TCTTTATCACTGAAATCCCATGG + Intergenic
988425360 5:31057434-31057456 TCACTATCACAAAAAAAGCATGG + Intergenic
988713702 5:33803815-33803837 TCATTATCACAAGAACAGCATGG + Intronic
988752604 5:34205446-34205468 TCATTATCACAAGAACAGCAAGG - Intergenic
988763896 5:34349260-34349282 TCACTATCACAAGAAAAGCACGG + Intergenic
989132618 5:38123149-38123171 TCATTATCACAAAAACAGCATGG + Intergenic
989386047 5:40855501-40855523 TCACTATCACAGGAACAGCATGG - Intronic
989429367 5:41334651-41334673 CCATTATCAAAGGAAACGGATGG - Intronic
990122752 5:52475593-52475615 TCATTATCACAAGAACAGCATGG - Intergenic
990186461 5:53215150-53215172 TCATTATCACAAAAACAGCATGG - Intergenic
991143374 5:63273294-63273316 TCACTATCACAGGAACAGCATGG + Intergenic
991385140 5:66079340-66079362 TCCATAACACAGAAAATGCATGG - Intronic
991446771 5:66708616-66708638 TCATAATAACAGAAAATGAAAGG - Intronic
991740371 5:69666260-69666282 TCATTATCACAAGAACAGCAAGG - Intergenic
991757127 5:69886907-69886929 TCATTATCACAAGAACAGCAAGG + Intergenic
991791946 5:70246001-70246023 TCATTATCACAAGAACAGCAAGG - Intergenic
991819834 5:70542377-70542399 TCATTATCACAAGAACAGCAAGG - Intergenic
991836530 5:70762789-70762811 TCATTATCACAAGAACAGCAAGG + Intergenic
991884395 5:71246339-71246361 TCATTATCACAAGAACAGCAAGG - Intergenic
993618876 5:90145078-90145100 TCACTATCACAAGAAAAGCATGG - Intergenic
994322285 5:98407410-98407432 TCACTATCACAGGAACAGCATGG - Intergenic
994325831 5:98443531-98443553 TCACTATCACAAAAACAGCACGG + Intergenic
994351450 5:98750951-98750973 TCATTATCACAACAACAGCATGG + Intergenic
994563768 5:101413534-101413556 TCATTATCACAAGAACAGCACGG + Intergenic
994666334 5:102709809-102709831 TCATTATTACAAAAACAGCATGG - Intergenic
995582169 5:113613559-113613581 TCACTATCACAGGAACAGCATGG - Intergenic
995872507 5:116757404-116757426 TCACTATCACAAGAAAAGCATGG - Intergenic
996033474 5:118732719-118732741 TCATTATCATGAAAAAAGCATGG - Intergenic
996049691 5:118917997-118918019 TCACTATCACAAAAACAGCATGG + Intronic
996156925 5:120113934-120113956 TCACTATCACAAAAACAGCAAGG - Intergenic
996481128 5:123975804-123975826 TCATTATCACAAGAATAGCAAGG + Intergenic
996616238 5:125444533-125444555 TCATTATCACAAGAACAGCATGG - Intergenic
997135118 5:131317368-131317390 TAATTATCACAGAAAATAGAAGG - Intronic
998144394 5:139718341-139718363 TCACTATCACAAAAATAGCACGG - Intergenic
998471120 5:142384684-142384706 TCATTGTTACAGAAAACTCAAGG + Intergenic
998753827 5:145353692-145353714 TCATTATCACAAGAACAGCATGG + Intergenic
999357461 5:150949351-150949373 TCATTAAAATAGAAAAGGCAAGG - Intergenic
999418317 5:151418960-151418982 TCATTATCACAAGAACAGCATGG - Intergenic
1000047049 5:157530492-157530514 TCATACTCACAGAAAAGGGAGGG - Intronic
1001258122 5:170200805-170200827 TCATTATCACAGAGCAAACAGGG + Intergenic
1003484567 6:6564462-6564484 TCAGTATCACAAAAACAGCAGGG + Intergenic
1003879886 6:10470560-10470582 TGAATATGACAGAAAACACATGG + Intergenic
1004430403 6:15537653-15537675 TCACTATCACAGGAACAGCATGG - Intronic
1004602095 6:17160064-17160086 TCACTATCACAGAAACAGCATGG - Intergenic
1005104393 6:22207637-22207659 TCACTATCACAAGAAAAGCATGG + Intergenic
1005256735 6:24011254-24011276 TCATTATCACAAGAACAGCATGG - Intergenic
1005550766 6:26912166-26912188 TCATTATCACAAGAACAGCAAGG - Intergenic
1005773705 6:29105483-29105505 TCATTTCCACAGAAAAAGCCTGG + Intergenic
1005984473 6:30862389-30862411 TCACACTCACAGAAAACCCAAGG - Intergenic
1006916764 6:37599732-37599754 TCATAATCACATAAAACGCACGG - Intergenic
1007104990 6:39277513-39277535 TCACTATCACAAAAACAGCATGG - Intergenic
1007671930 6:43562615-43562637 ACAGTATCACATAAAAGGCAAGG + Intronic
1008241086 6:49112622-49112644 TCACTATCACAGGAATAGCACGG - Intergenic
1008382908 6:50854115-50854137 TCATTATCAGAGGCAACGCTTGG + Intergenic
1008631683 6:53368010-53368032 TCACTATCACAAGAAAGGCATGG + Intergenic
1009177523 6:60478846-60478868 TCCTTATCACTGAAGACACAGGG - Intergenic
1009360809 6:62810319-62810341 TCACTATCACAAAAAGAGCATGG + Intergenic
1009761565 6:68013227-68013249 TCACTATCACAGGAAAGGAAGGG + Intergenic
1010004921 6:70985407-70985429 TCATTATCACAAGAACAGCAAGG + Intergenic
1010249413 6:73692734-73692756 TCACTATCACAAGAAAAGCATGG - Intergenic
1010830541 6:80523278-80523300 TCATTTTCAAAGAAAAAGGAAGG - Intergenic
1011704643 6:89988869-89988891 CCATTGTCACAGAAAACAGATGG - Intronic
1011799926 6:91000747-91000769 TCAGTATCACAGTAACAGCATGG - Intergenic
1012145476 6:95675244-95675266 TCATTATCACAAGAATAGCATGG + Intergenic
1012191057 6:96280268-96280290 TCACTAACACAGAAACAGCAAGG - Intergenic
1012251032 6:96981066-96981088 TCACTATCACAGGAACAGCATGG + Intronic
1012726277 6:102814926-102814948 TCCTTATCACTGAAGACACAGGG - Intergenic
1012751263 6:103166991-103167013 TCATTATCACAAGAAGAGCAAGG - Intergenic
1013799835 6:113930497-113930519 TCATTATCACAAGAACAGCATGG + Intergenic
1013947107 6:115734891-115734913 TCACTATCACAAGAAAAGCATGG - Intergenic
1013948228 6:115748220-115748242 TCATTATCACAGGAACAGCATGG + Intergenic
1014154056 6:118091380-118091402 TCATTATCACAAGAACAGCATGG - Intronic
1014342722 6:120229309-120229331 TCAGTCTCACAGAAACAGCATGG + Intergenic
1014731088 6:125032064-125032086 TCATTATCACAAGAATAGCATGG + Intronic
1014776085 6:125511388-125511410 TCACTATCACATAAACAGCATGG - Intergenic
1015105627 6:129533058-129533080 TCATTATCACGAAAACAGCATGG + Intergenic
1015520993 6:134131035-134131057 TCACTATCACAAAAACAGCAAGG - Intergenic
1015844317 6:137503712-137503734 TCATTATCACAAGAACAGCATGG + Intergenic
1016337753 6:143026177-143026199 TCACTATCACAAGAAAAGCACGG + Intergenic
1016508284 6:144810122-144810144 TCCTTATCACTGAAAACAGAAGG - Intronic
1017569321 6:155726160-155726182 TCATTATCACAAGAACAGCATGG - Intergenic
1017799019 6:157875375-157875397 TTATTATAAGAGAAAAGGCAGGG + Intronic
1019150558 6:170002871-170002893 TCATTATCACAAGAATAGCATGG + Intergenic
1020660477 7:10974783-10974805 TCATAATCACACCAAACACAGGG - Intronic
1021073750 7:16274893-16274915 TCATAAAAACAGAAAAAGCAAGG + Intronic
1021217612 7:17936613-17936635 TTATTATTACAGAAAACTAAAGG - Intronic
1021475954 7:21060660-21060682 TTATTATTAGAGAAAACACAAGG + Intergenic
1021800032 7:24295849-24295871 TCACTATCCCAGTAAAAGCACGG - Intergenic
1022352155 7:29576483-29576505 TCATTATCACAAGAACAGCATGG - Intergenic
1022519833 7:30999044-30999066 TCAGTATCACAGGAATAGCATGG + Intergenic
1024721058 7:52138222-52138244 TCATTATCACAAGAACAGCATGG + Intergenic
1025623788 7:63199541-63199563 TCATTGTGATAGAAAACGCCAGG - Intergenic
1025861937 7:65338447-65338469 TCACTATCACAGGAACAGCATGG - Intergenic
1026398074 7:69979108-69979130 TCATTCTAACAGAAAACCCAAGG - Intronic
1027722035 7:81755547-81755569 TCACGATCATAGAAAACTCAGGG + Intronic
1027785177 7:82571708-82571730 TCATTTCAACAGAAAAAGCAGGG - Intergenic
1028091088 7:86702439-86702461 TTAAAATCACAGAAAACACAGGG + Intronic
1029593237 7:101521186-101521208 TCACTATCACAAAAACAGCACGG + Intronic
1029944366 7:104516266-104516288 TCACTATCACAGGAATAGCATGG + Intronic
1030194945 7:106844264-106844286 TCAGTATCCCCGAAAACTCAGGG + Intergenic
1030417003 7:109257999-109258021 TCATTATCGCAAGAAAAGCATGG - Intergenic
1030799073 7:113827145-113827167 TCATTATCACAAGAACAGCATGG + Intergenic
1030866332 7:114705299-114705321 TCATTATCACAAGAACAGCATGG - Intergenic
1031614603 7:123866005-123866027 TCATTATCACAAGAACAGCATGG + Intronic
1031723003 7:125200520-125200542 TCCTTATCAAAGAAAAGGAAGGG - Intergenic
1032296831 7:130646695-130646717 TCACTATCACAAAAACAGCATGG - Intronic
1032467550 7:132155738-132155760 TAACTATCCCAGAAACCGCAGGG - Intronic
1032788438 7:135220926-135220948 TCATTATCACAATAACAGCATGG + Intergenic
1032865212 7:135917870-135917892 TCCTTATCACAAAAACAGCATGG - Intergenic
1033602962 7:142901997-142902019 TCAGTATCACGGAGAAGGCAGGG + Intergenic
1033735312 7:144215753-144215775 TCACTATCACAAAAATAGCATGG - Intergenic
1033747743 7:144335216-144335238 TCACTATCACAAAAATAGCATGG + Intergenic
1033780167 7:144659377-144659399 TCACTATCACAGGAACAGCACGG + Intronic
1034412511 7:150948615-150948637 TCCTTAACACAGAAAAAGTAGGG + Intronic
1034736774 7:153436375-153436397 TCATTATCACAAGAACGGCATGG - Intergenic
1035543633 8:461490-461512 TCACTATCACAAAAACAGCATGG + Intronic
1037027312 8:14055092-14055114 TCACTATCACAGGAACTGCACGG - Intergenic
1037123965 8:15322182-15322204 TCATTCTAAAAGAAAACTCAAGG + Intergenic
1037244154 8:16812548-16812570 TGATTATCACAGCAATTGCATGG + Intergenic
1038087147 8:24211275-24211297 TCATTATCACAAGAACAGCATGG - Intergenic
1038089092 8:24233758-24233780 TCACTATCACACGAAAAGCAAGG - Intergenic
1038386116 8:27147491-27147513 TCATTATCACAAGAACAGCAGGG - Intergenic
1038432701 8:27512855-27512877 TAATTCTCACAGAAATGGCATGG - Intronic
1038942475 8:32320611-32320633 TCACTATCACAAGAAAAGCAAGG + Intronic
1039081857 8:33741442-33741464 TCATTATCACAAGAACGGCAAGG + Intergenic
1039304045 8:36241853-36241875 TCAGTATCACAGGAATAGCATGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1040072199 8:43197613-43197635 TTATTATCTCAGAAAACACTTGG - Intronic
1040687032 8:49886231-49886253 TCACTATCACAAAAACAGCAAGG - Intergenic
1041095846 8:54348950-54348972 TAATTGTCAAAGAAAACACATGG + Intergenic
1041166447 8:55097176-55097198 TCACTATCACAAAAACAGCATGG - Intergenic
1041950733 8:63498218-63498240 TCACTATCACAAAAACAGCATGG + Intergenic
1042474617 8:69233067-69233089 TCATTATCACAAGAACAGCAGGG + Intergenic
1042631385 8:70820777-70820799 TCATTATCACATGAAGAGCATGG + Intergenic
1042842040 8:73133722-73133744 TGATTATCACAGCAACCCCACGG + Intergenic
1043704503 8:83331420-83331442 TCATTATCACAGGAACTGCATGG + Intergenic
1043825782 8:84927061-84927083 TCACTATCACAAAAACCGCGAGG + Intergenic
1044088895 8:87974889-87974911 TCACTATCACAGGAAACAGATGG + Intergenic
1044315067 8:90740669-90740691 TCACTATCACAAAAACAGCATGG + Intronic
1044362474 8:91304327-91304349 TCACTATCACAGGAACAGCAAGG - Intronic
1045638408 8:104220404-104220426 TTATTAACACAGACAAGGCAGGG + Intronic
1046223952 8:111252044-111252066 TCACTATCACAGGAACAGCATGG + Intergenic
1046290456 8:112153209-112153231 TCATTATGATAGAAAATTCAAGG - Intergenic
1046826322 8:118695809-118695831 TCATTATCACAAGAATAGCAAGG + Intergenic
1048376458 8:133826678-133826700 TCATCAGCTCAGAAACCGCATGG - Intergenic
1048526373 8:135206538-135206560 TCATTAACACAGGAACAGCAAGG - Intergenic
1048726276 8:137388531-137388553 TCACTATCACAAAAACAGCATGG + Intergenic
1051597316 9:18838222-18838244 TCATTATCACAAGAACAGCATGG + Intronic
1051634146 9:19166307-19166329 TCAGTATCACAAAAATAGCAAGG - Intergenic
1052626563 9:30982893-30982915 TCAGTATCACAAGAAAAGCATGG + Intergenic
1054806642 9:69402097-69402119 TCTTTATCTCTGAAGACGCAAGG + Intergenic
1056042688 9:82684923-82684945 TCACTATCACAAAAACAGCATGG + Intergenic
1056252186 9:84761005-84761027 GCTTTCTCACAGAAAATGCAGGG - Intronic
1056735003 9:89201868-89201890 TCATTACCACATGAAACGCCTGG + Intergenic
1056743110 9:89277084-89277106 TCACTATCACAAGAAAAGCATGG + Intergenic
1057520962 9:95760073-95760095 TCCTTATCTCAGAAGATGCAGGG - Intergenic
1057638563 9:96795420-96795442 TCACTATCACAGGAACAGCATGG + Intergenic
1057849098 9:98550810-98550832 TCATAATCACAGGGAATGCAGGG - Intronic
1058209071 9:102144753-102144775 TCATTATCACAAGAACAGCATGG + Intergenic
1058281361 9:103119540-103119562 TCACTATCACAAAAACAGCATGG + Intergenic
1059055726 9:110977339-110977361 TGACTACCACAGAAAACACATGG + Intronic
1059370235 9:113824861-113824883 TCATTATCACAAGAACAGCATGG + Intergenic
1062229939 9:135476433-135476455 TCATAATTAAAGAAAACTCAAGG - Intergenic
1185742619 X:2546091-2546113 TCACTATCACACAAACAGCAAGG + Intergenic
1185742769 X:2547095-2547117 TCATTATCACACAAACAGCAAGG - Intergenic
1185916310 X:4039300-4039322 TCATTATCACAAGAACAGCAAGG - Intergenic
1185938726 X:4288916-4288938 TCACTATCACAAAAACAGCATGG - Intergenic
1186117184 X:6317197-6317219 TTGTTATCACAGAAGACACATGG - Intergenic
1187353656 X:18545566-18545588 ACATTTTCACTGAAAAAGCAAGG - Intronic
1187613416 X:20967566-20967588 TCACTATCACAGGAACAGCATGG - Intergenic
1187628809 X:21145342-21145364 TCATTATCACAAGAACAGCATGG + Intergenic
1188047873 X:25449165-25449187 TCATTATCACAAGAACAGCATGG - Intergenic
1188461450 X:30432052-30432074 TCACTATCACAAAAACAGCACGG + Intergenic
1188758491 X:33995207-33995229 TCATTATCACAAGAACAGCATGG - Intergenic
1189958837 X:46306069-46306091 TCATTATCACAAGAACAGCATGG + Intergenic
1190375243 X:49782755-49782777 TCATTATCACAAGAACTGCATGG - Intergenic
1191041937 X:56091195-56091217 TCATTATCACAAGAATAGCATGG - Intergenic
1191140793 X:57114726-57114748 TCATTATCACAATAACAGCACGG + Intergenic
1192527890 X:71863200-71863222 TCATTATCACAGGAATAGCATGG + Intergenic
1193307623 X:79968166-79968188 TCACTATCACAAAAACAGCAAGG + Intergenic
1193549778 X:82877642-82877664 TCATTATCACAAGAAAAGCAAGG - Intergenic
1193944064 X:87710098-87710120 TCATTATCACAAGAACAGCATGG + Intergenic
1194180608 X:90706768-90706790 TCATTATCACAAGAACAGCATGG + Intergenic
1194568264 X:95520945-95520967 TCATTATCACAAGAACAGCATGG + Intergenic
1194982892 X:100458624-100458646 TCACTATCACAAAAACAGCATGG - Intergenic
1195376403 X:104232071-104232093 TCATTATCACAGTTAAAACATGG + Intergenic
1195427066 X:104746312-104746334 TAATTATCTCAGATAATGCATGG + Intronic
1195820322 X:108938245-108938267 TCACTATCACAAAAACAGCATGG - Intergenic
1196254063 X:113494947-113494969 TGATTTTCTGAGAAAACGCATGG - Intergenic
1196345531 X:114652105-114652127 TCATTATAAAAGAAAACACCTGG - Intronic
1196543866 X:116939831-116939853 TCACTTTCACAGAAAATGCGGGG - Intergenic
1196611528 X:117720074-117720096 TCATTATCACGAGAAAAGCATGG - Intergenic
1197082242 X:122433312-122433334 TCATTATCACAAGAAAAGCATGG + Intergenic
1197103812 X:122689142-122689164 TCACTATCACAAAAACAGCATGG - Intergenic
1197152937 X:123239732-123239754 CCATTATCACAGACAATGCTAGG - Intronic
1197320475 X:125023200-125023222 TCACTATCACAAAAATAGCATGG - Intergenic
1198276674 X:135100632-135100654 TCATTATCACAAGAACAGCATGG - Intergenic
1198304518 X:135367695-135367717 TCATTATCACAAGAACAGCATGG + Intergenic
1199098725 X:143772538-143772560 TATTTATCACTGAAAACCCATGG + Intergenic
1199112687 X:143954165-143954187 TCATTATCACAAAAACAACATGG - Intergenic
1199170808 X:144732789-144732811 TCATCATCACAAAAACAGCATGG + Intergenic
1199538920 X:148936192-148936214 TCATTATCACAGAAAACGCAAGG - Intronic
1199779460 X:151044857-151044879 TCACTATCACAGGAACAGCAAGG - Intergenic
1199824205 X:151481774-151481796 TCACTATCACAAAAACAGCATGG - Intergenic
1200527269 Y:4288928-4288950 TCATTATCACAAGAACAGCATGG + Intergenic
1201634567 Y:16108228-16108250 TCACTATCACAGAAAGAGCATGG + Intergenic
1201703363 Y:16908503-16908525 TCATTATCACAAGAACAGCATGG + Intergenic
1202196648 Y:22305254-22305276 TCATTATAACAGAAAATGATGGG + Intergenic
1202302395 Y:23430732-23430754 TCATTATCACAAAAAAAACTTGG - Intergenic
1202568416 Y:26239866-26239888 TCATTATCACAAAAAAAACTTGG + Intergenic