ID: 1199539664

View in Genome Browser
Species Human (GRCh38)
Location X:148945079-148945101
Sequence CTATATCCATGGCCGTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199539664_1199539674 12 Left 1199539664 X:148945079-148945101 CCCCACTACGGCCATGGATATAG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1199539674 X:148945114-148945136 CTGACCCTTGGCTTGGGCAGTGG 0: 1
1: 0
2: 2
3: 24
4: 235
1199539664_1199539669 0 Left 1199539664 X:148945079-148945101 CCCCACTACGGCCATGGATATAG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1199539669 X:148945102-148945124 CCTGCTATGACCCTGACCCTTGG 0: 1
1: 0
2: 2
3: 26
4: 208
1199539664_1199539670 5 Left 1199539664 X:148945079-148945101 CCCCACTACGGCCATGGATATAG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1199539670 X:148945107-148945129 TATGACCCTGACCCTTGGCTTGG 0: 1
1: 0
2: 3
3: 21
4: 136
1199539664_1199539671 6 Left 1199539664 X:148945079-148945101 CCCCACTACGGCCATGGATATAG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1199539671 X:148945108-148945130 ATGACCCTGACCCTTGGCTTGGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199539664 Original CRISPR CTATATCCATGGCCGTAGTG GGG (reversed) Intronic
900574597 1:3376833-3376855 CTGTGTCCCTGGCCGTGGTGTGG + Intronic
906326820 1:44851500-44851522 CTATATACCTGGCTGTGGTGAGG + Intronic
915598001 1:156906292-156906314 GTGTGTCCATGGCCGTTGTGTGG + Exonic
1063245246 10:4210964-4210986 TTATGTCGATGGTCGTAGTGTGG - Intergenic
1072927618 10:99630163-99630185 CTATACCCCTGGCTGGAGTGCGG + Intergenic
1081197084 11:40174666-40174688 CTATAACCATAGCAGCAGTGTGG + Intronic
1089880061 11:121765111-121765133 CTACACCCATGACCCTAGTGTGG + Intergenic
1090650633 11:128802937-128802959 CTATAGCCATGGCCATAATTTGG + Intronic
1093102021 12:15038740-15038762 CAATGTCCATGACAGTAGTGGGG + Intergenic
1103842117 12:123873584-123873606 GGATATCCATGGACGTGGTGCGG - Exonic
1104316644 12:127709442-127709464 GTCTTTCCATGGCCTTAGTGTGG - Intergenic
1120597217 14:86455922-86455944 GTATATCCATGGTCCTATTGTGG - Intergenic
1120951142 14:90043064-90043086 CCATATCCATGGCCGATCTGGGG - Exonic
1122964552 14:105116168-105116190 CTATTTCCCAGGCCGTGGTGAGG + Intergenic
1140346702 16:74220319-74220341 CTATACCCATGGCCGTTGTCTGG - Intergenic
1141360233 16:83388775-83388797 CTGTATCCATGGCCATCCTGGGG - Intronic
1159919617 18:74215707-74215729 TTAAATCCATGGCATTAGTGGGG - Intergenic
1168599323 19:57705412-57705434 CCATATCCATAACCCTAGTGTGG - Intronic
930708437 2:54527130-54527152 CTTTCTCCATGGCCCCAGTGAGG + Intronic
932613143 2:73214396-73214418 CTGTCTCCATGGCCGGACTGGGG - Intronic
941948661 2:171129796-171129818 CTATATCCCAGGCTGGAGTGCGG - Intronic
948254904 2:236559908-236559930 CTATATTAATGGACCTAGTGTGG - Intergenic
1173570299 20:44071522-44071544 CTATGCCCATGGCCCAAGTGGGG + Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949809650 3:7992447-7992469 CTATAATCATGGCTGTATTGAGG - Intergenic
953645203 3:44747187-44747209 CACTATGCATGGCCCTAGTGAGG + Intronic
970927045 4:21464907-21464929 CTTTTTCCATGGTCGTAGAGGGG - Intronic
971909688 4:32779427-32779449 CTTTATCCTTTGCAGTAGTGAGG + Intergenic
975432076 4:74305286-74305308 CTATATCCATGGCACTAGGCTGG - Intergenic
982135332 4:152269616-152269638 CTATTTCAATGGCCTTATTGTGG + Intergenic
998352638 5:141511407-141511429 CTGTACCCATGGGGGTAGTGGGG + Exonic
999005708 5:147975130-147975152 CTATATAAATAGCAGTAGTGGGG + Intergenic
1004895432 6:20143330-20143352 CTATTACCATGGCCTTAATGTGG - Intronic
1008391577 6:50958496-50958518 CTATATCCATGGCAATAGCATGG + Intergenic
1021202333 7:17741103-17741125 CAAGATCCATGGCTGAAGTGTGG - Intergenic
1024687722 7:51765806-51765828 CTATCCACATGGCAGTAGTGAGG - Intergenic
1052262124 9:26529209-26529231 GTATATCCTTGGGCATAGTGGGG - Intergenic
1056370180 9:85946212-85946234 CTATAGTCAAGGCTGTAGTGAGG - Intronic
1199539664 X:148945079-148945101 CTATATCCATGGCCGTAGTGGGG - Intronic