ID: 1199540692

View in Genome Browser
Species Human (GRCh38)
Location X:148955010-148955032
Sequence ACTGAGCTTTCGTCGGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199540692_1199540695 -7 Left 1199540692 X:148955010-148955032 CCATACACCGACGAAAGCTCAGT 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1199540695 X:148955026-148955048 GCTCAGTGGTTTCTATTTTTTGG 0: 1
1: 0
2: 0
3: 21
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199540692 Original CRISPR ACTGAGCTTTCGTCGGTGTA TGG (reversed) Intronic
900474916 1:2871584-2871606 CCTGAGCTTTCCTCTGTGTGGGG - Intergenic
907460663 1:54603666-54603688 TCTGAGCTTTCCCTGGTGTAGGG + Intronic
907552752 1:55318296-55318318 AAGTAGCTTTTGTCGGTGTAAGG - Intergenic
919724272 1:200872164-200872186 ACTGAGCTTACATCTGTGTCTGG + Intergenic
1063011688 10:2027672-2027694 ACAGAGCTCTGGTCGGTCTAGGG - Intergenic
1066133084 10:32413601-32413623 ACTCAGGTTCCTTCGGTGTATGG + Intergenic
1081455468 11:43218049-43218071 ATTGGGCTTTCCTCGGTGTCTGG - Intergenic
1103193382 12:119021405-119021427 GCTGAGCTTTCATCAGGGTAGGG + Intronic
1113476320 13:110584105-110584127 ACTGAGTTTCTGTAGGTGTATGG + Intergenic
1129535662 15:76311747-76311769 ACTGAGCTGACCTCGGGGTAAGG + Intergenic
1130179155 15:81607423-81607445 TCTGAACTTTCATCCGTGTAGGG + Intergenic
1142528229 17:560281-560303 ACTGAGCTTTCCTCTGTGGCAGG + Intronic
1151011114 17:70497509-70497531 ACTGTGCTTATGTCGGTCTAGGG - Intergenic
1155063105 18:22246051-22246073 ACTGAGCTTTTCTGGGTGTCAGG - Intergenic
1168535672 19:57167377-57167399 ACTGAGCTTTTGTTGGTTTGGGG - Intronic
928202878 2:29262093-29262115 ACTGACCTATCGTGGTTGTAAGG - Intronic
946829449 2:223712917-223712939 AATGAGCTTTCCTCAGTGGAAGG - Intergenic
1178488359 21:33032822-33032844 ACTGAGGTTTAGCCGGGGTAAGG + Intergenic
964630806 3:158808318-158808340 ACTGAGGTGGCCTCGGTGTAAGG + Intronic
964940059 3:162148220-162148242 ACTGAGCTTGCTTCTGTTTAGGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
992462008 5:76969838-76969860 ACTGAGCTTTGTTCCGTGTTTGG + Intronic
1013931952 6:115545233-115545255 ACTGAGCTCTTGTGGGTGAAGGG + Intergenic
1021219211 7:17955647-17955669 AGTCAGCTTTTGTGGGTGTATGG - Intergenic
1024630439 7:51242886-51242908 CCTGGGCTTTCCTCGGTGTCAGG - Intronic
1035604202 8:918905-918927 ACTGAGCTTTCAGTGCTGTAGGG + Intergenic
1048786934 8:138060691-138060713 ACAGAGCTCTTGTCGGTGCAGGG + Intergenic
1059946711 9:119416528-119416550 ACAGAGATTTAGTTGGTGTAAGG - Intergenic
1186956817 X:14691612-14691634 ATTGAGGTTTAGTTGGTGTAAGG - Intronic
1188336246 X:28937231-28937253 ACTGTGCTTTCATGGGTGAAAGG - Intronic
1199540692 X:148955010-148955032 ACTGAGCTTTCGTCGGTGTATGG - Intronic