ID: 1199542090

View in Genome Browser
Species Human (GRCh38)
Location X:148968468-148968490
Sequence ATTTGAGAACGACTGTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 322}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199542087_1199542090 -10 Left 1199542087 X:148968455-148968477 CCCAATTGCAGATATTTGAGAAC 0: 1
1: 0
2: 0
3: 30
4: 286
Right 1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG 0: 1
1: 0
2: 6
3: 71
4: 322
1199542084_1199542090 2 Left 1199542084 X:148968443-148968465 CCCCAGGAGATTCCCAATTGCAG 0: 1
1: 0
2: 1
3: 47
4: 259
Right 1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG 0: 1
1: 0
2: 6
3: 71
4: 322
1199542082_1199542090 23 Left 1199542082 X:148968422-148968444 CCAGGAATGAGTATTAAAGCTCC 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG 0: 1
1: 0
2: 6
3: 71
4: 322
1199542081_1199542090 24 Left 1199542081 X:148968421-148968443 CCCAGGAATGAGTATTAAAGCTC 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG 0: 1
1: 0
2: 6
3: 71
4: 322
1199542086_1199542090 0 Left 1199542086 X:148968445-148968467 CCAGGAGATTCCCAATTGCAGAT 0: 1
1: 0
2: 0
3: 16
4: 115
Right 1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG 0: 1
1: 0
2: 6
3: 71
4: 322
1199542085_1199542090 1 Left 1199542085 X:148968444-148968466 CCCAGGAGATTCCCAATTGCAGA 0: 1
1: 0
2: 0
3: 20
4: 225
Right 1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG 0: 1
1: 0
2: 6
3: 71
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199542090 Original CRISPR ATTTGAGAACGACTGTCCTA GGG Intronic
901685882 1:10943105-10943127 CTTTGAGAACCACTGTTCTGAGG + Intergenic
901715634 1:11151480-11151502 GTTTGAGAACTACTGCTCTAAGG - Intronic
902212563 1:14914236-14914258 CTTTGAGAACCGCTGCCCTAGGG + Intronic
902553653 1:17234026-17234048 GTTAGAGAAAGACTGTCCTGAGG - Intronic
902959445 1:19952277-19952299 TTTTGAGAACCACTATTCTAAGG - Intergenic
903732041 1:25503757-25503779 GTTTGAGAATGATTGTTCTAAGG - Intergenic
904766398 1:32851870-32851892 ATTTGCGAACCACTGGTCTAGGG + Intronic
905315368 1:37079421-37079443 TTTTGAGAGCCACTGGCCTAAGG - Intergenic
905948863 1:41928181-41928203 ATTTGAGAATTACTGTAATAGGG - Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
906262273 1:44403085-44403107 ATTTGATAACCACTGTAATAAGG - Intergenic
906707989 1:47908861-47908883 AGTTCAGACAGACTGTCCTAAGG - Intronic
906967794 1:50475708-50475730 ATGTGAGAAGGACTGGACTATGG + Intronic
908197168 1:61756511-61756533 GTTTGAGAACCACTAACCTAGGG + Intronic
908478562 1:64513337-64513359 AATTGAGAAATACTGTTCTAAGG + Intronic
908618763 1:65952192-65952214 GTTTGAGAACCATTGTCCTAGGG + Intronic
908675522 1:66599242-66599264 ATTTGGGAACCTCTGTCCTAGGG + Intronic
909241492 1:73220015-73220037 GTTTGAGAACTACTGATCTAAGG + Intergenic
909762816 1:79313944-79313966 ATTTGGGTACCACTGCCCTATGG - Intergenic
910693767 1:89991168-89991190 ATTTGAGAAGTACTGACCCAGGG + Intergenic
911524568 1:98968516-98968538 ATTTGAGAAACATTGACCTAGGG - Intronic
912170123 1:107089759-107089781 ATTCGAGAAAGACCGTCATATGG - Intergenic
912965496 1:114233101-114233123 CTTTAAGAACCACTGTTCTAGGG - Intergenic
913974702 1:143445894-143445916 ATTTAAGAACCACTGACCTAGGG + Intergenic
914069093 1:144271510-144271532 ATTTAAGAACCACTGACCTAGGG + Intergenic
914110062 1:144694844-144694866 ATTTAAGAACCACTGACCTAGGG - Intergenic
914902778 1:151720645-151720667 ATTTGTGAACAACTGCCCTAAGG - Intronic
915283978 1:154841323-154841345 GTTTGGGAACCACTGTCCCAGGG - Intronic
915947289 1:160162738-160162760 AGTTGAGAACCACTGTGTTAGGG + Intronic
916452191 1:164931491-164931513 ATTTGAGAACCACTGCCCTAAGG + Intergenic
917277663 1:173347972-173347994 AGTTGAGAATCACTGGCCTAAGG + Intergenic
918235330 1:182574731-182574753 AGTTGAGAACTACTGCCTTAAGG + Exonic
918502594 1:185214946-185214968 ATGTGAGATCCACTGGCCTAGGG - Intronic
918885771 1:190191766-190191788 GTTTGAGAACCAGTGTCCTAAGG + Intronic
920578146 1:207078430-207078452 ATTTGAGAAGCACTGTTCTAGGG + Intronic
920835187 1:209504377-209504399 CTTTGAGCACCATTGTCCTAAGG + Intergenic
922391269 1:225145599-225145621 GTTTGAAAACCACTGTCTTAAGG - Intronic
924205669 1:241708887-241708909 ATTTTGGAACGACTGCACTAAGG + Intronic
924617228 1:245622406-245622428 ATTCGGCAACCACTGTCCTAAGG - Intronic
924666688 1:246080532-246080554 GGTTGGGAACCACTGTCCTAGGG + Intronic
1062996359 10:1870548-1870570 ATTTGAGAACCTCTGCCCAAGGG + Intergenic
1065252224 10:23827277-23827299 AGTTGAGAACCACTGGCCTAAGG + Intronic
1065801546 10:29357211-29357233 GTTTGAGAGCCACTGCCCTAGGG + Intergenic
1065926973 10:30443391-30443413 ATTTTGGAAGGACTGTCATAAGG - Intronic
1066223424 10:33358115-33358137 GTTTGAGAACCACTGGGCTAGGG + Intergenic
1066522934 10:36243104-36243126 GTTTGAGAACCACTGCCCTCAGG + Intergenic
1066694259 10:38064035-38064057 ATTTGAAAATGTCTGTCGTAGGG - Intronic
1066998261 10:42583154-42583176 ATTTGAAAATGTCTGTCTTAGGG + Intronic
1067992888 10:51235921-51235943 ATTTGAGAACCACTGACCTTGGG - Intronic
1068797673 10:61102041-61102063 ATATGAGAACCACTGTCCTACGG + Intergenic
1069039057 10:63675537-63675559 CTTTGAGAACCAGTGGCCTAGGG + Intergenic
1069331930 10:67303105-67303127 GTTTGAGAACCACTGACATAAGG + Intronic
1069443440 10:68450541-68450563 GTTTAAGAACCACTGTTCTACGG + Intronic
1071823693 10:89303210-89303232 TTTTGAGAACCACTGTCTTAGGG - Intronic
1072167815 10:92830733-92830755 AGTTGAGAACCACTAGCCTAGGG + Intergenic
1072354120 10:94589256-94589278 ATTTGAGAATCCCTGTACTAAGG + Intronic
1074429215 10:113379344-113379366 CTTTGAGAACCACTGGCTTAAGG - Intergenic
1075435854 10:122441000-122441022 CTTTGAGAACCACTGCCTTAGGG - Exonic
1075449641 10:122541023-122541045 ACTTGAGAACCACAGTCCTAGGG - Intergenic
1075968809 10:126635655-126635677 ATTTGAAAACTACTGTCCGCAGG - Intronic
1076941236 10:133610568-133610590 ATAGGAGAAAAACTGTCCTATGG + Intergenic
1078474087 11:11615858-11615880 GTTTGAAAACCACTGCCCTAAGG + Intronic
1078871389 11:15348431-15348453 ACTTGAGAAGCACTGTGCTAGGG + Intergenic
1079676355 11:23231711-23231733 ATTTGAGAAAGACTGTCTTGAGG - Intergenic
1082779773 11:57278056-57278078 TTTTGAAAACCACTGTCCCAAGG - Intergenic
1085131102 11:74039593-74039615 TTTTGCGAACTACTGTCCTAGGG + Intronic
1085166059 11:74400322-74400344 ATATGAGAACCACTGATCTATGG - Intergenic
1085320529 11:75571333-75571355 GTTTGAGAAAGACTGATCTAAGG - Intronic
1086459366 11:86990598-86990620 GTTTGAGAACTATTGTCTTATGG - Intergenic
1088518066 11:110660086-110660108 ATTTGACAACCACTGACCTAGGG - Intronic
1089868711 11:121654082-121654104 ATTTGAGAACGTGAGTCCTGTGG + Intergenic
1090295344 11:125582985-125583007 ATTTGAGAAGTACTTTTCTATGG - Intronic
1090298026 11:125607675-125607697 ATTTGAGAACCACCGATCTAAGG + Intronic
1092041747 12:5391082-5391104 AGTGGAGAACCATTGTCCTAGGG + Intergenic
1092658297 12:10711001-10711023 GTTTGAGAACCACTGACCTAAGG + Intronic
1094259842 12:28481251-28481273 AGTTGAGAAACACTATCCTAAGG - Intronic
1094386614 12:29901233-29901255 ATTTGAGAATGACTTTACTCAGG - Intergenic
1095417326 12:41990877-41990899 TTTTGAGAACCACTGTGGTAGGG - Intergenic
1096585551 12:52617475-52617497 CTTTGAGAACCACTGCTCTAGGG + Intronic
1096661516 12:53128074-53128096 GTTTGAGAACTACAGTTCTAAGG - Intergenic
1098251021 12:68569741-68569763 GTTTGAGAACCATTTTCCTAGGG + Intergenic
1100325494 12:93536062-93536084 CTTTGAGAACTACTGCTCTAGGG - Intergenic
1100716143 12:97307909-97307931 GCTTGAGAACCACTGGCCTAGGG + Intergenic
1100989049 12:100232581-100232603 CTTTGAGAAACACTGGCCTAAGG + Intronic
1105660403 13:22487887-22487909 GTTTGAGAACTACTACCCTAAGG + Intergenic
1106114825 13:26808331-26808353 GTTTTAGAACTACTGTTCTAGGG - Intergenic
1106220564 13:27743217-27743239 GGTTGAGAACAACTGCCCTAGGG + Intergenic
1106223743 13:27769743-27769765 ATTTGACATCAACTGTCCAAAGG - Intergenic
1107106643 13:36650253-36650275 CTTGGAGCACCACTGTCCTAAGG - Intergenic
1110533500 13:76624303-76624325 ATTTGAGCACTTCTTTCCTAAGG + Intergenic
1111657697 13:91174208-91174230 TTTTGAGAGCCACTGCCCTAGGG - Intergenic
1112709724 13:102113690-102113712 ATTTGAGAACCACTGGTCAAAGG + Intronic
1113638820 13:111942828-111942850 AATTGAGAACCACTGGCATAAGG + Intergenic
1114273694 14:21122054-21122076 GTTTGAGAACCATTGCCCTAAGG + Intergenic
1114331338 14:21639971-21639993 CTTTGAGAACGCCTGTCTTTGGG + Intergenic
1114664849 14:24371506-24371528 AGTTGAGATCCACTGTCCTAGGG + Intronic
1114776344 14:25486668-25486690 ATTTGAAAACCAGTGTCCAATGG - Intergenic
1115151982 14:30296421-30296443 GTTTGAGAACCACTGCTCTAAGG - Intergenic
1117059967 14:51952079-51952101 GGTTGAGAACCACTGTCCTATGG + Intronic
1117125665 14:52621745-52621767 ATTTGAGAACCATTGCTCTAGGG - Intronic
1117199365 14:53372586-53372608 GTTTGAGAACCACTGTGTTATGG + Intergenic
1117449278 14:55835457-55835479 ATTTGAGAAGCACTGCACTAAGG - Intergenic
1118804871 14:69227273-69227295 AGTTGAGAACTACTATTCTAGGG + Intronic
1118866167 14:69705378-69705400 CTTTGAGAACGACTGGTGTAGGG - Intronic
1120266681 14:82259695-82259717 AGTTGAGAACCACTGGCCTAAGG - Intergenic
1120313454 14:82860968-82860990 ATTTGAGACCGAGTGACCCAAGG - Intergenic
1120653763 14:87165199-87165221 GTTTAAGAACCACTGTTCTAGGG - Intergenic
1120909576 14:89653812-89653834 ATTTGAGAACCACTGCCCTAGGG + Intergenic
1127430584 15:58903425-58903447 GTTTGAGAACCACTGCTCTAAGG - Intronic
1127529170 15:59826132-59826154 ATTTGAGATCTACTGCCCTAAGG + Intergenic
1127604027 15:60568112-60568134 AGTTGAGAACCACTGTTTTATGG + Intronic
1128847153 15:70909364-70909386 ATTTGAGAACCACTGTTTTAGGG + Intronic
1129059687 15:72850881-72850903 GTTTGAGAACCACTGTGCTAAGG + Intergenic
1130890908 15:88133155-88133177 TTTTGAGAACCACTGGCCTGAGG + Intronic
1131433059 15:92401851-92401873 ATTTGGGAACCACTGACCTAGGG - Intronic
1132034613 15:98472061-98472083 GTGTGAGAACCACTGACCTAAGG - Intronic
1134748221 16:16604464-16604486 AGTTGAGAACTACTGGCCTCAGG - Intergenic
1134997242 16:18749159-18749181 AGTTGAGAACTACTGGCCTCAGG + Intergenic
1135028121 16:19014366-19014388 ACTTGAGAACCACTGATCTAAGG + Intronic
1135271924 16:21077076-21077098 AGTTGAGAACCACTGTTGTAAGG + Intronic
1135619024 16:23937272-23937294 GTTTCAGAACCACTGTTCTAAGG + Intronic
1135871333 16:26153973-26153995 GTTTGAGAACCAATGTCTTATGG - Intergenic
1136265913 16:29118261-29118283 CATTGAGAACCACTGTTCTAAGG + Intergenic
1137798058 16:51238538-51238560 ATTTCAGAACAACTATACTAAGG + Intergenic
1138237330 16:55395718-55395740 CTTTGAGAACCACTGTTCTAAGG - Intronic
1138366546 16:56483312-56483334 ATTTGACAAGGGCTGTCCTAGGG - Intronic
1138745221 16:59355468-59355490 AGTTGAGAACCACTGGCTTAAGG - Intergenic
1139892887 16:70265405-70265427 ACTTGAGAACCACTGATCTAGGG + Intronic
1141408900 16:83818890-83818912 TTTTAAGAACCACTGCCCTATGG - Exonic
1141416503 16:83879601-83879623 ATAGGAGAAAAACTGTCCTATGG - Intergenic
1141816675 16:86415116-86415138 AGTTGAGAACCACTGCTCTATGG + Intergenic
1142710495 17:1720799-1720821 ATTTGAAAACTACTGCCCTAGGG + Intronic
1142869801 17:2812635-2812657 GTTTGAGAACCACCGTCCTGGGG - Intronic
1142891438 17:2946669-2946691 AAGTGAGAACCACTGACCTATGG - Intronic
1143600314 17:7941297-7941319 ATTTGAGAACCACAATCCTTTGG + Intronic
1143942747 17:10559603-10559625 ATTTCAGAATCACTGCCCTAAGG + Intergenic
1146909553 17:36639763-36639785 CTTGGAGAACCACTGGCCTATGG - Intergenic
1148964626 17:51424277-51424299 CTTTGAGAACCACTGCCTTAAGG - Intergenic
1149418532 17:56485780-56485802 ATTTGAGAAGCACTGTTCTAGGG - Intronic
1149689822 17:58566059-58566081 ATTTGAGAACCACTGCTTTAGGG + Intronic
1149810074 17:59660189-59660211 ATTTGAAAACAAATGTCATAGGG - Intronic
1150711216 17:67532285-67532307 CTTTGAGAACCATTGTTCTAGGG + Intronic
1150749803 17:67850011-67850033 GTTTGAGAACCACTGTTTTAAGG + Intronic
1151372916 17:73660332-73660354 CTTTGAGAACCACTCTTCTAAGG + Intergenic
1153212509 18:2783316-2783338 CTTTGAGAAGGGCTGTCCCAGGG + Intronic
1153555570 18:6309934-6309956 GTTTGAGAACCATTGTCCTAGGG - Intronic
1153719676 18:7889172-7889194 ATTTGATAAGGAGTGTCTTAAGG + Intronic
1154273694 18:12941533-12941555 ATTTGAGTAGGAGTGTCCAATGG + Intergenic
1156663042 18:39371011-39371033 ATTTTTGCAAGACTGTCCTATGG - Intergenic
1157107752 18:44790773-44790795 AGTTGAGAAGCACTGTCCTAGGG + Intronic
1157978439 18:52352806-52352828 GTTTGAGAATCAGTGTCCTAGGG + Intronic
1158518591 18:58151264-58151286 ATTTGAGAATGGCTCTCCAAGGG + Intronic
1159313846 18:66744675-66744697 AGTTAAGAATCACTGTCCTAGGG + Intergenic
1159726958 18:71972950-71972972 TTTTGAGAACCAATTTCCTAGGG - Intergenic
1159892551 18:73966268-73966290 AGTTGAGAACTACTGCCTTAAGG + Intergenic
1164630355 19:29757875-29757897 CTTTCAGAACCACTGACCTAGGG - Intergenic
1168430818 19:56278600-56278622 ATTTGAGAACAAATTTCTTAGGG + Intronic
1168493793 19:56833720-56833742 CTTTGAGAACCACTGCTCTAAGG + Intronic
924967876 2:94622-94644 ATAGGAGAAAAACTGTCCTATGG + Intergenic
924982888 2:239238-239260 AATTAAGCACGAATGTCCTAAGG + Intronic
929068076 2:38000226-38000248 GGTTGAGAACCACTGCCCTAGGG - Intronic
929426947 2:41853533-41853555 GTTTGAGAATCACTGTTCTAGGG - Intergenic
929969254 2:46559718-46559740 AGTTGAGAACCACTGTTGTAGGG + Intronic
930398140 2:50848367-50848389 ATTGGAGAATAACTTTCCTAGGG - Intronic
930515703 2:52405501-52405523 ATTTGAGAACCACTGCTATAAGG + Intergenic
931736328 2:65198057-65198079 AGTTGAGAACCACTGTCCAACGG - Intergenic
931910334 2:66892210-66892232 TTTTGAAAACCACTGCCCTAAGG - Intergenic
931939596 2:67237581-67237603 ATTTAAGAACCACTGATCTAGGG + Intergenic
932733156 2:74234728-74234750 CTTTGAGAATCACTGTTCTAAGG + Intronic
933471736 2:82734733-82734755 TTTTGAGAAAGACAGTACTATGG + Intergenic
933608995 2:84414811-84414833 ATTTGAGGATGACTCTCCTGTGG + Intergenic
933640309 2:84751910-84751932 CTTTGAGAACCACTGTTTTAAGG + Intronic
933706469 2:85294493-85294515 CTTTGAGAACCACTGGCATAGGG + Intronic
933744369 2:85560077-85560099 AGTTGAGAACTACTGGGCTAAGG + Intronic
934179402 2:89606869-89606891 ATTTAAGAACCACTGACCTAGGG + Intergenic
934289692 2:91681132-91681154 ATTTAAGAACCACTGACCTAGGG + Intergenic
935033162 2:99342044-99342066 ATTTGAGGACTGCTGGCCTAGGG + Intronic
935646382 2:105338575-105338597 CTTTGACCACCACTGTCCTAAGG + Intronic
937119161 2:119430231-119430253 CTTTGAGAACCACTGAGCTAAGG - Intronic
938966691 2:136394850-136394872 ATTTGAAAACCACTATCTTAGGG - Intergenic
939164876 2:138629651-138629673 ATTTGAGAGCAACAGTCTTACGG - Intergenic
940349690 2:152668341-152668363 TTTTGAGAACCACTGCCTTAAGG + Intronic
941200660 2:162505017-162505039 ATTTAAGAAGGACTTACCTATGG + Intronic
942153805 2:173106492-173106514 AATTGAGAACCACTGAACTAGGG + Intronic
942433165 2:175938100-175938122 GTTTGAGAACAACTGGCCTAGGG + Intronic
942614050 2:177771355-177771377 CTTTGAGAAGCACTGACCTATGG + Intronic
943812100 2:192199792-192199814 GATTGAGAACCACTGTCCTGGGG + Intergenic
945335164 2:208583370-208583392 GTTTGAGAACCACTGGCTTAGGG + Intronic
945700447 2:213162887-213162909 ATTTGAAAAATACTGTTCTAGGG - Intergenic
946184396 2:217971014-217971036 ATTTGAGAACCATTGGTCTATGG - Intronic
946378694 2:219330207-219330229 CTTTGAGAACTACTGCTCTAAGG + Intronic
946945628 2:224818895-224818917 GTTTGAGAACCACTGAGCTATGG - Intronic
947161886 2:227223280-227223302 AGTTGAGAACCACTGTCCTAAGG + Intronic
1169202981 20:3723278-3723300 AGTTGAGAACTCCTGACCTAAGG - Intergenic
1170311900 20:15001338-15001360 TTTTGAGAACCACTATCCAAAGG + Intronic
1170412281 20:16104596-16104618 TTTTGAGAACTCCTGACCTAGGG - Intergenic
1170913816 20:20602968-20602990 GGCTGAGAACGACTGTCTTAGGG + Intronic
1171097332 20:22344154-22344176 TTTTCAGAACCACTGGCCTAGGG - Intergenic
1173300459 20:41797795-41797817 CTTTGAGAACCCCTCTCCTATGG + Intergenic
1173347804 20:42216986-42217008 TTTTGAGAACTACTGGTCTATGG + Intronic
1174283604 20:49456710-49456732 TTTTGAGAACTCCTGACCTAGGG + Intronic
1174709193 20:52686977-52686999 ATTGGAGAACCACTGGTCTAGGG - Intergenic
1177436290 21:21057705-21057727 ATTTAAGAAAGACTTTCCTAAGG + Intronic
1178746247 21:35253075-35253097 GTTTAAGAACTACAGTCCTAGGG + Intronic
1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG + Intergenic
1181914513 22:26268825-26268847 AGTTGAGAACCAGTGGCCTATGG + Intronic
1182607198 22:31515130-31515152 CTTTGATAACCACTGTTCTATGG + Intronic
1182655013 22:31883200-31883222 AGCTGAGAACCGCTGTCCTAGGG + Intronic
1183139280 22:35921292-35921314 ACTTGAGAACCACTGTCATAGGG - Intronic
1183140802 22:35937076-35937098 GGTTGAGAACTACAGTCCTATGG - Intronic
949957878 3:9284914-9284936 CTTTTAGAACCACTGCCCTAAGG + Intronic
951245387 3:20335473-20335495 ATTTGAGAACCACTATTTTAGGG + Intergenic
951678754 3:25272673-25272695 GGTTGAGAACCACTGCCCTAAGG + Intronic
952223924 3:31354107-31354129 AGTTGAGAACCACTGCTCTAGGG - Intergenic
952766011 3:36955069-36955091 GGTTGAGAACCACTGTTCTAAGG - Intergenic
953598590 3:44340673-44340695 GTTTGAGAACCACTGTATTAGGG - Intronic
953805058 3:46061630-46061652 ATTTTAAAAGGACTGTCCTAAGG - Intergenic
953831252 3:46299246-46299268 CTTTGAGAACCACTGTTCTATGG - Intergenic
954970082 3:54644670-54644692 GTTTGAGAACTACTGTTTTATGG - Intronic
954976213 3:54697402-54697424 GTTTGAGGACCACTGTCTTAGGG + Intronic
955012969 3:55037470-55037492 ATTTCAGAACTTGTGTCCTAGGG + Intronic
955376863 3:58404540-58404562 AGTTGAGAGCTACTGACCTATGG + Intronic
955823369 3:62920055-62920077 CTTTGAGAACCACTGTTCTGGGG + Intergenic
956128550 3:66034050-66034072 TTTTAAGAACTACTGTACTAGGG - Intronic
956270101 3:67442341-67442363 GTTTGAGAACCACTGTTCTGGGG - Intronic
956813890 3:72890223-72890245 CTTTGAGAACCACTGTCAAAGGG - Intronic
957571398 3:81951244-81951266 GTTTGAGAACCACTGAGCTATGG + Intergenic
957901177 3:86493711-86493733 CTTGGAGAAACACTGTCCTAGGG - Intergenic
959117579 3:102196177-102196199 ATTTTTGAAAGACTATCCTATGG + Intronic
959371848 3:105536827-105536849 GTTTGAGAACCACTGTCCTTGGG - Intronic
959458464 3:106593028-106593050 ATTTGAAAACGACTAACATATGG - Intergenic
959910795 3:111761599-111761621 GTTTGAGAACGACTGGCCTCTGG - Intronic
960193709 3:114739257-114739279 GTTTGAGAACTACAGTCTTAAGG + Intronic
960677385 3:120209376-120209398 ATTTAAGAACCACTGTTCTAGGG - Intronic
961104448 3:124229278-124229300 GTTTGAGAACAACTGCCTTAGGG - Intronic
961619738 3:128214367-128214389 ATTTGAGAACCATTGTGCTGTGG + Intronic
962983248 3:140509461-140509483 CTTTGAGAACCACTGTTCTGAGG + Intronic
963306388 3:143658255-143658277 TCTTGAGAACCACTGCCCTAAGG + Intronic
964507482 3:157415406-157415428 CTCTGTGAAAGACTGTCCTAGGG + Intronic
964546114 3:157835468-157835490 ATTTGGGAAGGACTGCACTAGGG - Intergenic
965215207 3:165854799-165854821 ATTTGAGAACTACTGTTTTAGGG - Intergenic
965418658 3:168428609-168428631 AATTGAGAACCACTGTTTTAAGG + Intergenic
965584510 3:170305178-170305200 ATCTGAGAACTAATGCCCTATGG - Exonic
966588437 3:181653087-181653109 CTTTGAGAGCCACTGTTCTAGGG - Intergenic
967024871 3:185555974-185555996 ATTTGAAAACAACTGCCCTCTGG + Intergenic
967094989 3:186170312-186170334 CTTTGAGAACCACTGACCAATGG - Intronic
967131817 3:186477482-186477504 GTTTGAGAACCACTGTACTAAGG + Intergenic
969829880 4:9786754-9786776 ATTTAAGAACCACTGACCTAGGG - Intronic
969849973 4:9948403-9948425 ATTTGACGGCCACTGTCCTAGGG + Intronic
970186464 4:13459664-13459686 TTTTGAGAAAGAGTGTACTAGGG - Intronic
972842129 4:42943751-42943773 ACTTGAGAGCCACTGACCTAGGG - Intronic
973550849 4:52034729-52034751 ATTTGAAAACTACTGATCTAGGG - Intronic
974005524 4:56552760-56552782 ATTTAAGAACCACTGACCAAGGG - Intronic
974191792 4:58513982-58514004 ATTTGAGAACTACTGTATCAGGG + Intergenic
975223282 4:71839316-71839338 AATTGAGAACCACTGTGTTACGG + Intergenic
975540882 4:75510616-75510638 ATTTGAGAACTACTGTTCTGCGG - Intronic
976479979 4:85530795-85530817 TTTTGAGAATGAATTTCCTAGGG - Intronic
976885993 4:89984798-89984820 ATTTGTGAATGACTTTCCTGAGG - Intergenic
977263652 4:94828826-94828848 ATGTGAGAACCACTGCACTAGGG + Intronic
980762781 4:137257852-137257874 CTGAGAGAACTACTGTCCTAGGG - Intergenic
981517075 4:145620938-145620960 CTTTGAGAACCACTGTCCTAGGG + Intronic
981672441 4:147302280-147302302 ATTTGAGAACCACTGCTCTAGGG - Intergenic
981715499 4:147747888-147747910 ATTTGAGAACCACTGGTCTAGGG - Intronic
982500301 4:156146069-156146091 AATTTAGAAAGACTTTCCTATGG - Intergenic
982658570 4:158178786-158178808 CTTTGAGAACCACTGGCCTTGGG - Intergenic
982768421 4:159373722-159373744 ATTTGAGAATTTCTGTCTTAAGG + Intergenic
983391473 4:167136220-167136242 AGTTGAGAACCACTGTTCTATGG + Intronic
984254403 4:177373737-177373759 ATTTGAGGACCCCTGTCCTCTGG + Intergenic
986252918 5:6077361-6077383 ACTTGAGCATGGCTGTCCTAGGG - Intergenic
987576935 5:19741756-19741778 AGTTAAGAACTACTGCCCTAGGG - Intronic
987837898 5:23185624-23185646 AGTTGACACAGACTGTCCTATGG + Intergenic
989304966 5:39944026-39944048 GTTTGAGAACTGCTGCCCTATGG + Intergenic
990026413 5:51196398-51196420 AGTTGAGAACCACTGACATAGGG - Intergenic
990479607 5:56196851-56196873 TTTTGACAATCACTGTCCTAGGG - Intronic
990533488 5:56697231-56697253 GTTTGAGAACCACTGTAGTAGGG - Intergenic
990536774 5:56730959-56730981 AGTTGAAAACCACTGACCTATGG - Intergenic
990813225 5:59752560-59752582 AGTTAAGAACTACTGCCCTAGGG - Intronic
990817656 5:59803667-59803689 GTTTGAGAACGAGTGCTCTAAGG + Intronic
991008591 5:61857418-61857440 GTTTGAGAACTCCTGTTCTAGGG + Intergenic
992185661 5:74242005-74242027 GTTTGAGAACCACTGGCCTAAGG + Intergenic
992294731 5:75316693-75316715 ATTTGAGAAACCCTGTTCTAGGG + Intergenic
992318649 5:75587618-75587640 ATTTAAGAAACACTGACCTAGGG + Intronic
992351612 5:75934723-75934745 TTTTGAGTTCTACTGTCCTATGG + Intergenic
992659904 5:78948841-78948863 ATTTGAGAACCTCTGAGCTAAGG - Intronic
993234281 5:85282849-85282871 CTTTGAGAACCACTGTTCTAGGG - Intergenic
993248204 5:85479878-85479900 CTTTGAGAACCACTGCCCTAAGG - Intergenic
994190952 5:96868618-96868640 ATTTGAGAACCACTAGCCTAGGG - Intronic
994211477 5:97091329-97091351 AATTGAGAACCACTGTTATAAGG + Intronic
994801663 5:104384768-104384790 GTTTGAGAACCACTTTACTAAGG + Intergenic
995169817 5:109094540-109094562 ATTTGTCAACCACTGTTCTAAGG - Intronic
996396085 5:123015524-123015546 CTTTGAAAACCACTGTCCTGGGG - Intronic
996396106 5:123015680-123015702 GTTTGAGAACCACAGTCCTAGGG + Intronic
996430336 5:123369019-123369041 GTTTGAGAACTACTGTTCTAAGG + Intronic
997421827 5:133775490-133775512 AGTTGAGAAACACTGTGCTAAGG + Intergenic
997470040 5:134112552-134112574 GTCTGGGAACAACTGTCCTATGG - Intergenic
997650576 5:135514818-135514840 GTTTGAGAAGCACTGCCCTAGGG - Intergenic
998690897 5:144586276-144586298 CTTTGAGAACCACAGACCTAGGG - Intergenic
999597797 5:153224330-153224352 ATTTGAGAATCATTGGCCTACGG + Intergenic
999715514 5:154356854-154356876 ATTTGAGAAGCACTGGTCTAAGG - Intronic
999835387 5:155364728-155364750 GTTTGAGAAGCACTGTCCTAGGG + Intergenic
1000060902 5:157654456-157654478 CTTTGAGAACCACTGTACTAGGG + Intronic
1000065916 5:157693305-157693327 CTTTGAGAACCACGGTACTAAGG + Intergenic
1000214979 5:159146650-159146672 GTTTGAGAACCACTATGCTAAGG + Intergenic
1000703590 5:164483347-164483369 ATTTGAGAACTACTGTATTATGG + Intergenic
1001380966 5:171306485-171306507 CTCTGAGAACCACTGTCCTAGGG + Exonic
1003043318 6:2709682-2709704 AGTTGAGAACAATTGCCCTAGGG + Intronic
1003477310 6:6495566-6495588 ATGTGAGAATCACTGTTCTAGGG - Intergenic
1003479386 6:6517227-6517249 ATTTGGGAACCAGTGACCTAGGG - Intergenic
1003900937 6:10654775-10654797 CTTTGAGAACACCTGTCATAGGG + Intergenic
1005257080 6:24014668-24014690 ATTTTAGAACTTCTGTCCAACGG - Intergenic
1005390363 6:25326684-25326706 GTTTGAGAACCACTGGTCTAGGG + Intronic
1006966412 6:37990225-37990247 CTTTGAGAATCACTGGCCTAGGG + Intronic
1007034303 6:38658972-38658994 GTCTGAGAACTGCTGTCCTAGGG + Intergenic
1008288135 6:49679608-49679630 ATTTGTGATTGACTGACCTAAGG - Intergenic
1009449534 6:63785089-63785111 TTTTGAGAACCACTGTACAAAGG + Intronic
1011281496 6:85682334-85682356 GTTTGAGAACCACAGTCTTAGGG + Intergenic
1013654999 6:112237417-112237439 ATTTGAGAACCACTATGCTGGGG - Intronic
1014282941 6:119462121-119462143 GTTTGAGAACCACTTTCCTAAGG + Intergenic
1016241546 6:141937379-141937401 ATTTGAGAACAACTGGAATAAGG + Intergenic
1016301822 6:142640290-142640312 ATTTGAGAACCACTCCCCCAGGG - Intergenic
1017380943 6:153828876-153828898 ATTTGAGAATCACTGCCATAGGG - Intergenic
1018405519 6:163477738-163477760 ATTTGAGAATCACTTTTCTAAGG + Intronic
1018431806 6:163728818-163728840 AGTTGAGAACCACTGGGCTAGGG - Intergenic
1022330768 7:29376573-29376595 GTGTGAGAACTACTGTTCTAAGG + Intronic
1022614018 7:31910049-31910071 AATTGAGAACCACTATTCTAGGG + Intronic
1022788189 7:33660069-33660091 CGTTGAGAACCACTGGCCTAGGG - Intergenic
1023271353 7:38466480-38466502 GTTTGAGAATCACTGTCTTAAGG - Intronic
1023576559 7:41634562-41634584 AGTTGAAAACCACTGCCCTAAGG + Intergenic
1023902342 7:44491656-44491678 GTTTCAGAACCACTGTTCTAGGG - Intergenic
1024987784 7:55210525-55210547 AGTTGAGAACTACTGGCCTAGGG + Exonic
1026566232 7:71491812-71491834 CTTTGAGATGCACTGTCCTACGG + Intronic
1027366975 7:77468744-77468766 GTTTGAGAACCACTGCCCTAGGG + Intergenic
1028325380 7:89517931-89517953 GTTTGAGAACCACTGGCCTAGGG + Intergenic
1028367528 7:90050978-90051000 AGTTGAGAACATATGTCCTATGG - Intergenic
1028682157 7:93547984-93548006 ACTTGAAAACCACTGTCTTAGGG - Intronic
1030072341 7:105708937-105708959 GTTTGAGAACCACTGCTCTAGGG - Intronic
1031210999 7:118825950-118825972 GTTTGAGAAGCCCTGTCCTAGGG + Intergenic
1031450178 7:121906501-121906523 ATTTTAGAACCAATGTCTTAAGG + Intronic
1035592504 8:827006-827028 ATTTGAGAACCACTGCCATAAGG - Intergenic
1036538392 8:9675861-9675883 ATTTCAGAACCACTCTCCTAAGG - Intronic
1037428946 8:18789149-18789171 CTTTGAGAACCACTGTGCTGTGG - Intronic
1038276510 8:26125929-26125951 ATCTGAGAACTCCTGTCCTGTGG - Intergenic
1039359507 8:36860660-36860682 ATTTGGGCACAACTTTCCTAAGG - Intronic
1041134046 8:54736860-54736882 GTTTGAGAAGCACTGGCCTAGGG + Intergenic
1042011263 8:64247474-64247496 CTTTGAGAACCACTGACTTAGGG - Intergenic
1042112668 8:65397342-65397364 GTTTGAGAACTGCTGACCTAGGG + Intergenic
1042314199 8:67408229-67408251 ATCTGAGAACTACTGATCTAAGG + Intergenic
1045280222 8:100743511-100743533 ATTTGAGAATCACTGATCTAGGG - Intergenic
1045605084 8:103763942-103763964 ATTTGAGAACCACCGGTCTATGG - Intronic
1046299529 8:112269103-112269125 AGTTGAGAACCACTGTGCTGAGG + Intronic
1047137541 8:122097434-122097456 ATTTGAGAAATACTGCCCAAAGG + Intergenic
1047362513 8:124182225-124182247 GTTTGAGAACCGCTGTTCTAAGG - Intergenic
1047786240 8:128156349-128156371 AGTTGAGAACCACTGTGGTAGGG + Intergenic
1047905964 8:129473727-129473749 AGCTGAGAACCACTGGCCTAGGG - Intergenic
1048157589 8:131974056-131974078 AGTTAAGAACCACTGTCCTAAGG - Intronic
1048410280 8:134165298-134165320 ATTTGATTATCACTGTCCTAAGG - Intergenic
1049928712 9:434997-435019 AGTTGAGAACCACTGCTCTAAGG - Intronic
1049950350 9:637625-637647 ACTTGAGAACCACTGTCCTATGG + Intronic
1050152314 9:2629009-2629031 CTTTGAGAACCACTGCACTAAGG - Intronic
1050542662 9:6683304-6683326 ATTTTAGAAAGACTGACCAAAGG - Intergenic
1054725792 9:68648734-68648756 ATTTCAGAACCACTTTGCTAAGG - Intergenic
1054754806 9:68946806-68946828 GTTTGAGAGCTAATGTCCTAAGG - Intronic
1055335974 9:75233943-75233965 GTTTGAGAACTACTGGTCTAAGG - Intergenic
1056114134 9:83425602-83425624 ATTTTAGAAAGACCTTCCTATGG + Intronic
1056438634 9:86597746-86597768 ATTTGAGAACCACTGGACTAGGG - Intergenic
1057928800 9:99175686-99175708 GCTTGAGAACCACTGCCCTAAGG + Intergenic
1060219854 9:121758697-121758719 ACTTGAGAGCCACTGTCCCAGGG - Intronic
1061761887 9:132857157-132857179 AATTGAGAACCACTGGCTTAGGG - Intronic
1186105986 X:6206391-6206413 ATTTGACAAAGACTGTAATATGG - Intronic
1186530835 X:10293989-10294011 ACTTGAGAACCACTTTCCTTAGG - Intergenic
1187510537 X:19913671-19913693 CTTTGAGAACCACTGTATTAAGG + Exonic
1187969974 X:24649294-24649316 CTTTGAGAACCACTGCTCTAAGG - Intronic
1188024732 X:25196156-25196178 CTTTGAGAACCACTGCTCTATGG + Intergenic
1188322379 X:28755788-28755810 ATTTGAGAACCACTGATCTAAGG - Intronic
1188565610 X:31522998-31523020 GTTTGAGAACCACTGTACTAAGG - Intronic
1188589922 X:31821194-31821216 GTATGAGAACAACTGCCCTAGGG - Intronic
1189420733 X:40855502-40855524 ATTTGAGAAGCACTGCCCCAGGG - Intergenic
1189513457 X:41686599-41686621 TTTTGAGAACCACTGGACTAAGG + Intronic
1189867540 X:45346676-45346698 CTTTGAGAACCACTGATCTAAGG + Intergenic
1190459902 X:50662115-50662137 ATCTGAGAACTACTGTTCTAGGG + Intronic
1190533387 X:51403377-51403399 AGCTGAGAACAACTGTACTATGG + Intergenic
1191735543 X:64384697-64384719 ATTTGAGAACCAGTGTCTTAAGG + Intronic
1192356808 X:70411707-70411729 AGTTGAGAACAACTGGCTTAGGG + Intronic
1193713701 X:84910335-84910357 CTCTGAGAACCACTGGCCTAAGG + Intergenic
1193860220 X:86656128-86656150 ATTTGAAAATGACTGTCCAGGGG - Intronic
1194045883 X:89002467-89002489 ATTTGAGAACAACTATACAAGGG - Intergenic
1195032270 X:100937544-100937566 CTTCGAGAAAAACTGTCCTAGGG + Intergenic
1195523101 X:105853138-105853160 CTTTGAGAACCACTATGCTAAGG - Intronic
1195904082 X:109826985-109827007 GTTTGAGAACTGATGTCCTAGGG - Intergenic
1195940260 X:110161879-110161901 CTTTGAAAACAACTGTCCTAGGG - Intronic
1196030145 X:111087990-111088012 ATTTGGGAACCACTGTATTAGGG - Intronic
1196048459 X:111280606-111280628 AGTTGAGAACCACTGTTGTAAGG + Intergenic
1196322890 X:114363631-114363653 GTTTGTGAACCACTGTCTTAAGG - Intergenic
1196965046 X:121046844-121046866 GTTTGAGAACCATTGTCCAAGGG + Intergenic
1197310393 X:124898085-124898107 GTTTGAGAGCCACTGTTCTAGGG - Intronic
1197565702 X:128082574-128082596 ATATGAGAACGAGTGTTGTATGG - Intergenic
1197852781 X:130881398-130881420 TTTTGAGAACCACTGTTCAAAGG - Intronic
1197854448 X:130900421-130900443 TTTTGAGAACCACTGACCTATGG + Intronic
1198132494 X:133711341-133711363 CTTTGAGAACCACTATGCTAGGG - Intronic
1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG + Intronic