ID: 1199544122

View in Genome Browser
Species Human (GRCh38)
Location X:148989346-148989368
Sequence CACAGCCATCACATTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199544122_1199544125 -3 Left 1199544122 X:148989346-148989368 CCAGGAGCAATGTGATGGCTGTG 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1199544125 X:148989366-148989388 GTGCTGATGTTAGGGTGAAATGG 0: 1
1: 0
2: 1
3: 11
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199544122 Original CRISPR CACAGCCATCACATTGCTCC TGG (reversed) Intronic
900178806 1:1302473-1302495 CTCAGCCGTCCCTTTGCTCCTGG - Intronic
900548982 1:3244258-3244280 CACAGATAACACATTGCTCGGGG - Intronic
901647857 1:10726415-10726437 CATGGCCATCACAGTCCTCCTGG + Intronic
902677899 1:18021615-18021637 GCTAGCCATGACATTGCTCCAGG + Intergenic
903303148 1:22393173-22393195 CCCAGCCGTCAGCTTGCTCCTGG - Intergenic
904895071 1:33811042-33811064 AACAGCAGTCACAGTGCTCCAGG - Intronic
907281261 1:53348831-53348853 CTCAGCCCTCACGTGGCTCCAGG - Intergenic
910314493 1:85866839-85866861 AACACCCATCACAGTTCTCCAGG + Intronic
910436107 1:87207782-87207804 CACAGCCAACACCTGGCTCTTGG + Intergenic
910737506 1:90476912-90476934 CACAGCCAACACATATGTCCAGG - Intergenic
912921502 1:113871812-113871834 CACAGCCATCATCTCACTCCAGG + Intergenic
915649841 1:157301646-157301668 CCCAGCCAGCACATTACTCCAGG - Intergenic
915661596 1:157409911-157409933 CCCAGCCAGCACATTACTCCAGG + Intergenic
917662016 1:177186190-177186212 CTCAACCCTCTCATTGCTCCTGG + Intronic
920052212 1:203171096-203171118 CACAGGCAACACAGAGCTCCTGG - Exonic
920077759 1:203349628-203349650 TACAGCCCTCACATTGCTGTTGG + Intronic
924092661 1:240517726-240517748 CACACACATCAAATAGCTCCTGG + Intronic
1064065576 10:12178253-12178275 CACAGCCATCCCTGTGCTCCTGG + Intronic
1064313832 10:14236463-14236485 CACAGCCAGGACACTGCTGCTGG + Intronic
1064845526 10:19648083-19648105 CACAGCCTTCACATTCTTCTAGG - Intronic
1066341073 10:34534282-34534304 CACAGCATTCACATTCCTTCTGG - Intronic
1066384343 10:34929539-34929561 CTCAGCCCTCACGTTGCTCAAGG + Intergenic
1070343932 10:75523524-75523546 CACAGTCCCCACATAGCTCCTGG - Intronic
1074088454 10:110226273-110226295 CCCAGCCATTACCTCGCTCCCGG - Intronic
1074270172 10:111945542-111945564 CACAGTCTTCACATACCTCCAGG + Intergenic
1074693184 10:116025467-116025489 CTCACCCATCCCTTTGCTCCAGG - Intergenic
1080418876 11:32092817-32092839 CACAGCCATCCCTGTGCTCCTGG + Intronic
1084501218 11:69536561-69536583 ATCAGCCATCACCTTGTTCCTGG + Intergenic
1084641454 11:70428994-70429016 CACAGCAAAAACACTGCTCCTGG - Intronic
1085129490 11:74025932-74025954 CACACCCATCACATTTATGCTGG - Intronic
1090242510 11:125194066-125194088 CAAAGACATCACGTTGCTCTTGG - Intronic
1090244456 11:125205989-125206011 CACAGCCATCTCTTTCTTCCTGG - Intronic
1090420379 11:126571296-126571318 CACAGCCATCAGCTTTCTCTGGG + Intronic
1091044101 11:132310502-132310524 CACAGGCCTTACAATGCTCCTGG - Intronic
1093277380 12:17146827-17146849 CACAGCCAGCCCATAGCCCCTGG + Intergenic
1094737883 12:33255806-33255828 CACACCAATCACATTCCTTCTGG - Intergenic
1096817009 12:54208095-54208117 CACAGCCTTCACTTAGGTCCAGG - Intergenic
1102603610 12:114052013-114052035 CACTACCATCACATTGCTGGCGG + Intergenic
1102669411 12:114604664-114604686 CACAGCCACCACACACCTCCAGG + Intergenic
1108118679 13:47160109-47160131 CCCAGACATCACTGTGCTCCTGG + Intergenic
1109359725 13:61280455-61280477 AACAGCCTTCACATTGATGCAGG + Intergenic
1109736760 13:66496303-66496325 CTCAGACATCACATACCTCCAGG + Intronic
1110068303 13:71138539-71138561 CACAGCTATCATACTGCACCTGG + Intergenic
1111750668 13:92327845-92327867 CACAGCCTTCTCATTCTTCCAGG + Intronic
1113760286 13:112841780-112841802 CACAGCGATCACAGTGTTACTGG + Intronic
1113878138 13:113607439-113607461 CACAAGCATCATTTTGCTCCAGG - Intronic
1120622489 14:86781360-86781382 CACAGACCTTACTTTGCTCCTGG + Intergenic
1120821045 14:88912195-88912217 CATTGCCATCACTCTGCTCCAGG - Intergenic
1122552721 14:102558729-102558751 CACAGCCATCTCTGTCCTCCCGG - Intergenic
1123403852 15:20009296-20009318 CACTGCCTTCACCTTCCTCCTGG - Intergenic
1123513192 15:21015942-21015964 CACTGCCCTCACCTTCCTCCTGG - Intergenic
1124020009 15:25911967-25911989 CAAAGCCAACACAATTCTCCAGG + Intergenic
1126510506 15:49466680-49466702 CATTGCCATCACATTAGTCCAGG - Intronic
1128335029 15:66780316-66780338 CACAGGAATCCCACTGCTCCAGG + Intronic
1129388198 15:75207247-75207269 CACAGCCCGCACATTGTTCTGGG - Exonic
1129952428 15:79603847-79603869 CACTGCCTTTACATTGCTTCAGG - Intergenic
1133749450 16:8713159-8713181 CACAGCCATGACGGGGCTCCGGG - Exonic
1133849109 16:9485439-9485461 CACAGCCAGCACAATCCTCATGG - Intergenic
1135733980 16:24916216-24916238 CAGGGCCATCACAATGGTCCAGG + Intergenic
1136867216 16:33767968-33767990 CACAGCCATCACCCTGGTCCGGG + Intergenic
1138404467 16:56778539-56778561 CTCAGCTACCACATTGGTCCTGG - Intronic
1138682837 16:58698656-58698678 CAATTCCTTCACATTGCTCCAGG + Intergenic
1139794758 16:69473463-69473485 CAGACCCAACACAGTGCTCCAGG - Intergenic
1141288521 16:82695194-82695216 CACAGCCTCCTCATTGCCCCAGG - Intronic
1141524648 16:84603890-84603912 CAGAGGCCTCACATGGCTCCCGG + Intronic
1141574327 16:84954421-84954443 CACTGGCATCCCATGGCTCCTGG - Intergenic
1203104946 16_KI270728v1_random:1348235-1348257 CACAGCCATCACCCTGGTCCGGG - Intergenic
1203128568 16_KI270728v1_random:1614133-1614155 CACAGCCATCACCCTGGTCCGGG + Intergenic
1142984872 17:3689612-3689634 GACGTCCATCACATTGCTTCTGG + Exonic
1144205959 17:12979757-12979779 CCCTGCCCTCACATTGCTCACGG + Intronic
1148682211 17:49480975-49480997 CCCAGCCATCAGATTGGTTCAGG - Intergenic
1151062441 17:71111614-71111636 CACATGCCTCACCTTGCTCCTGG + Intergenic
1151385255 17:73751332-73751354 CACAGCCATGACTGTGCTCATGG - Intergenic
1152341787 17:79729672-79729694 CACAGCCACCACCCTGGTCCGGG + Intergenic
1153224773 18:2891180-2891202 CATAGTCATCACACTGCTGCTGG - Exonic
1156376882 18:36522732-36522754 CACAGCCATGGCATGGCTCTGGG - Intronic
1161417789 19:4157319-4157341 CACCGCCCTCACCTTGTTCCAGG + Intronic
1165825010 19:38700793-38700815 CCCAGCTGTCCCATTGCTCCTGG + Intronic
1166137083 19:40784065-40784087 CACAGCCCTCACCATTCTCCTGG - Exonic
1167243362 19:48358837-48358859 CAGAGCCCTCCCATGGCTCCCGG + Intronic
1167702010 19:51054385-51054407 TACGGCCATCACCTTGGTCCAGG + Intergenic
1167702038 19:51054531-51054553 CAGAGCCCTCTCATAGCTCCTGG + Intergenic
1167856133 19:52241679-52241701 CACATCCAGCACATTTATCCTGG + Intergenic
925319436 2:2950960-2950982 CTCAGCCATCTCATGGCTACAGG + Intergenic
925764814 2:7222159-7222181 CTCAACCATCACAATGCTCATGG - Intergenic
926410318 2:12595972-12595994 CACAGCCACCTCATTCATCCTGG - Intergenic
926478286 2:13356262-13356284 CACAGACATCACATTTCTCCAGG + Intergenic
931325530 2:61218242-61218264 CACAGCTCTCACATAGCTCTTGG + Intronic
931736705 2:65200511-65200533 CACAAGCATCACAATGATCCAGG + Intergenic
933158012 2:78995138-78995160 CAGAGCCAGCACCTTTCTCCTGG + Intergenic
933296238 2:80494327-80494349 CACAGCCATCACAGCTTTCCTGG - Intronic
935145692 2:100393657-100393679 TACAGGCATGAGATTGCTCCTGG - Exonic
938573183 2:132581405-132581427 CAGAGCCATCACATGGTTTCTGG - Intronic
939447788 2:142332879-142332901 CACTGCCAACACATTGATCAGGG + Intergenic
939698616 2:145360519-145360541 CACCGACCACACATTGCTCCCGG + Intergenic
943125159 2:183787691-183787713 CACTGCCATTACATTGTTCCTGG + Intergenic
944943734 2:204659018-204659040 GCCAGCTATCACATTGTTCCAGG + Intronic
946158455 2:217821913-217821935 CACAGACTCCACATAGCTCCGGG + Exonic
947092025 2:226522413-226522435 CACAGCAATCACATCCCTCCTGG + Intergenic
947305431 2:228740938-228740960 CACATCCATGACATCGCCCCTGG - Intergenic
947544460 2:231001181-231001203 GGCAGCCATGACACTGCTCCTGG - Intronic
1170399321 20:15962809-15962831 CACAGACAGGACATTGCTCAGGG - Intronic
1170504807 20:17014241-17014263 CATAGTCATCATATTGATCCTGG + Intergenic
1171183525 20:23108988-23109010 CAAAGTCACCAAATTGCTCCAGG - Intergenic
1172591726 20:36122554-36122576 CCCAGCCATCGCACTGCTCATGG - Intronic
1173750428 20:45471097-45471119 CACCGCCATCCCATGGCTGCTGG + Intronic
1174929744 20:54800004-54800026 CACAGACATCACATTACTGCTGG - Intergenic
1175447975 20:59038426-59038448 TACAGCAGTCACATTTCTCCGGG + Intronic
1177265277 21:18775129-18775151 CTCAGGCCTCCCATTGCTCCAGG - Intergenic
1177567341 21:22842815-22842837 CACTGGGATCACATTGTTCCAGG + Intergenic
1178304849 21:31482827-31482849 CACAGTCCTTACATTGCTCTGGG - Intronic
1178494414 21:33074811-33074833 CCCAACCATCACCTTGCTCTTGG - Intergenic
1181331952 22:22099505-22099527 CACAGACACCCCAGTGCTCCAGG + Intergenic
1182521332 22:30886097-30886119 CACAGCCATGACATAGCTCTTGG + Intronic
1182656906 22:31897899-31897921 CCCACCCACCACTTTGCTCCAGG - Intronic
1184714577 22:46273552-46273574 CACAGCCAGCACACGGCTCCCGG - Intronic
1184866177 22:47202863-47202885 CACTGCCATCACAGGCCTCCAGG + Intergenic
949820638 3:8112165-8112187 GACACCCATCATATTGCTTCGGG - Intergenic
950368472 3:12506770-12506792 GAAAGCCATCACAGAGCTCCTGG - Intronic
951527563 3:23668476-23668498 ACCAGCCATCTCATTCCTCCTGG + Intergenic
953075122 3:39562287-39562309 CACAGCCAACAGATTGGTACAGG + Intergenic
957264864 3:77949905-77949927 AACAGCCTTCTCTTTGCTCCTGG + Intergenic
958460400 3:94387159-94387181 CACAGTCATCAGATTCTTCCAGG + Intergenic
960070520 3:113424871-113424893 CACTGCCTTCTCACTGCTCCAGG - Intronic
962751898 3:138439720-138439742 CAAAATCCTCACATTGCTCCAGG + Intronic
963919654 3:150893386-150893408 CACAGCCATCTGAATGCTTCGGG + Intronic
964525347 3:157611086-157611108 CACAGCCTTCACATTGTGACAGG - Intronic
965127098 3:164645456-164645478 CAAAGCCATCACATTTTACCTGG + Intergenic
968180816 3:196593880-196593902 CACTGCCATCACCTTGCTCTTGG - Intergenic
968980396 4:3845819-3845841 CACAGCCATCACAGTGCTCACGG - Intergenic
972901480 4:43690262-43690284 CAGTGACATCACATTGCTTCTGG - Intergenic
974336264 4:60549290-60549312 CAAAGCCATCTCCTTTCTCCTGG + Intergenic
974891556 4:67890282-67890304 CACTGCCACCACATGACTCCAGG + Intergenic
977324430 4:95556609-95556631 CACAGCAAGCACAAGGCTCCAGG - Intergenic
979684481 4:123496403-123496425 CACAGCCTTCACATACCTTCCGG - Intergenic
983304339 4:165966746-165966768 CACAGAGATCACATGCCTCCAGG + Intronic
986361432 5:6981896-6981918 CACAGCCAGCCCATTTCTCAAGG + Intergenic
986361453 5:6982041-6982063 CACAGCCAGCCCATTTCTCAAGG + Intergenic
986712536 5:10498476-10498498 CCCAGCCAGCACCTTGCTTCGGG - Intergenic
987996370 5:25286287-25286309 TGCAGCTATCACATTACTCCAGG + Intergenic
989278564 5:39616216-39616238 CACACCCATCCCATTTCTCTGGG + Intergenic
991703881 5:69339628-69339650 CACTTCCATGACTTTGCTCCAGG - Intergenic
994900065 5:105760042-105760064 CACAGTCATCACATGGCTGGCGG - Intergenic
997428111 5:133818167-133818189 CACAGCCCTCAGCATGCTCCAGG + Intergenic
998172075 5:139878378-139878400 CAAAGCCATCTCTTTTCTCCGGG + Intronic
999309978 5:150545611-150545633 CTCAGCCATCACCACGCTCCAGG - Intronic
1000738660 5:164936927-164936949 CAAAGTCATCACAATGCTCATGG - Intergenic
1000958377 5:167569929-167569951 CATAGCTATCACAGTGCTCTCGG - Intronic
1002801225 6:522959-522981 CACAGCCATTTCATGGCGCCTGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1005385172 6:25279013-25279035 CGCAGCCAGCAGATGGCTCCCGG + Intergenic
1007636476 6:43302664-43302686 CACTGCCAGGACAGTGCTCCAGG - Exonic
1008279122 6:49574352-49574374 CACAGCCTCCACATTGCACTGGG - Intergenic
1010958410 6:82117862-82117884 CCAACCCAACACATTGCTCCAGG + Intergenic
1012246137 6:96927843-96927865 CAGAGCAAACACACTGCTCCTGG + Intronic
1013730317 6:113156929-113156951 AACAGCATTCACATTGCTGCTGG + Intergenic
1016833363 6:148454225-148454247 CACAGCGCTCACATTCCTGCTGG - Intronic
1018185310 6:161261488-161261510 CACATTCACCACACTGCTCCAGG + Intronic
1018777776 6:167034208-167034230 CACAGCAATCCCAGTGCCCCAGG - Intronic
1019265698 7:116400-116422 CACACCCATCATTCTGCTCCGGG + Intergenic
1019360271 7:601284-601306 TACATCCATCCCATTGCCCCAGG + Intronic
1020835323 7:13142331-13142353 CACAGCCAACACATTTCACCAGG - Intergenic
1025295928 7:57775329-57775351 CACAGCCATCACTTTGGACATGG - Intergenic
1030582429 7:111374834-111374856 TACAGCTATCACATTGCTGAGGG + Intronic
1032109037 7:129059659-129059681 CACCGCCAACACTTTACTCCAGG - Intergenic
1032298523 7:130665564-130665586 CACAGCACTAACATTGCACCAGG + Intronic
1033004473 7:137546400-137546422 CACAGCCATCAGGTTTCCCCAGG + Intronic
1033596477 7:142863177-142863199 CCCAGCCACCACCCTGCTCCTGG - Exonic
1033766678 7:144500570-144500592 CTCAGCCATTACATTGATCTCGG - Intronic
1035090438 7:156305747-156305769 GACAGCCAGCACAGTGCTGCAGG + Intergenic
1035475460 7:159140901-159140923 GAGAGCCATCAGATGGCTCCAGG + Intronic
1036138360 8:6182626-6182648 CACACCCATCACATTGTTGGAGG + Intergenic
1037098411 8:15014165-15014187 CTCAGCTACCACAGTGCTCCAGG - Intronic
1039840049 8:41286590-41286612 CACAGCCACTAGAATGCTCCAGG + Intronic
1040891050 8:52316369-52316391 CACAGCACTCTCATTGCTGCTGG - Intronic
1040899330 8:52402491-52402513 CACAGCATTGACATGGCTCCAGG + Intronic
1044235751 8:89828256-89828278 CACTGCAATCTCATTGTTCCAGG + Intergenic
1045299440 8:100898592-100898614 GAGAGCCCTCACATTGCACCAGG - Intergenic
1046270253 8:111886572-111886594 GTCAGACATCATATTGCTCCAGG + Intergenic
1047046793 8:121062850-121062872 CACAGCCATCACATAACCCAAGG + Intergenic
1048273298 8:133046416-133046438 CACATCCCTCACAGTGCTCTAGG + Intronic
1048542183 8:135352659-135352681 AGCAGGCATCACATTGTTCCTGG - Intergenic
1049161597 8:141101691-141101713 CACTGCCCTCCCACTGCTCCCGG + Intergenic
1049380808 8:142314923-142314945 GACAGCCATGACAGTGCTCCGGG + Intronic
1053509451 9:38675289-38675311 CACAGCCGGCACAATGCTGCTGG - Intergenic
1053800265 9:41759592-41759614 CAAAGCCATTGCATGGCTCCAGG + Intergenic
1054144931 9:61555243-61555265 CAAAGCCATTGCATGGCTCCAGG - Intergenic
1054188693 9:61971744-61971766 CAAAGCCATTGCATGGCTCCAGG + Intergenic
1054649828 9:67616873-67616895 CAAAGCCATTGCATGGCTCCAGG - Intergenic
1056804528 9:89718374-89718396 CAGAGCCATCAGAGTGATCCTGG + Intergenic
1057266097 9:93619215-93619237 CCCAGCCATCTCCTGGCTCCTGG + Intronic
1057423329 9:94929151-94929173 CATAGCAACCACAGTGCTCCCGG - Intronic
1059298154 9:113290893-113290915 CACAGCTATCACATTGCAACCGG + Exonic
1060221085 9:121764487-121764509 CACGGCCACCAGCTTGCTCCTGG + Intronic
1061329144 9:129881317-129881339 CACAGCCCCCACATCCCTCCAGG - Exonic
1062716579 9:138013446-138013468 CACAGCCCTCACATTGTGGCTGG + Intronic
1187163852 X:16786949-16786971 CACCGCCGTCACCGTGCTCCCGG + Intronic
1187726862 X:22212334-22212356 CACAGCATTCACAATGCCCCAGG - Intronic
1187946022 X:24427107-24427129 CACAGCCCACACATTGCGCATGG - Intergenic
1190067130 X:47249116-47249138 CACAGACAGCACATTTGTCCTGG - Intergenic
1196285717 X:113877316-113877338 CACAGCCAGCACATAGATCGTGG - Intergenic
1197270099 X:124415819-124415841 CACTGGCATCACATTGATGCAGG - Intronic
1199544122 X:148989346-148989368 CACAGCCATCACATTGCTCCTGG - Intronic
1199875220 X:151923054-151923076 CAGGGCCCTCACATTTCTCCAGG - Intronic