ID: 1199545834

View in Genome Browser
Species Human (GRCh38)
Location X:149006658-149006680
Sequence ACACAGAGATTATTCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199545834_1199545838 4 Left 1199545834 X:149006658-149006680 CCCACCCAGAATAATCTCTGTGT No data
Right 1199545838 X:149006685-149006707 GAACTCAAATTAAACTGATGAGG No data
1199545834_1199545839 5 Left 1199545834 X:149006658-149006680 CCCACCCAGAATAATCTCTGTGT No data
Right 1199545839 X:149006686-149006708 AACTCAAATTAAACTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199545834 Original CRISPR ACACAGAGATTATTCTGGGT GGG (reversed) Intergenic
No off target data available for this crispr