ID: 1199546045

View in Genome Browser
Species Human (GRCh38)
Location X:149008162-149008184
Sequence CTCTGACACCACTGGCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199546045_1199546049 12 Left 1199546045 X:149008162-149008184 CCATGTAGCCAGTGGTGTCAGAG No data
Right 1199546049 X:149008197-149008219 GCTGTAATCCTCCCAGGGACAGG No data
1199546045_1199546047 6 Left 1199546045 X:149008162-149008184 CCATGTAGCCAGTGGTGTCAGAG No data
Right 1199546047 X:149008191-149008213 AGCTCAGCTGTAATCCTCCCAGG No data
1199546045_1199546048 7 Left 1199546045 X:149008162-149008184 CCATGTAGCCAGTGGTGTCAGAG No data
Right 1199546048 X:149008192-149008214 GCTCAGCTGTAATCCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199546045 Original CRISPR CTCTGACACCACTGGCTACA TGG (reversed) Intergenic
No off target data available for this crispr