ID: 1199555308

View in Genome Browser
Species Human (GRCh38)
Location X:149101757-149101779
Sequence AATCAGAGAGAGAGCGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199555308_1199555317 18 Left 1199555308 X:149101757-149101779 CCTCCCACGCTCTCTCTCTGATT No data
Right 1199555317 X:149101798-149101820 TTTCCACCTTGCAAGCCTGAAGG No data
1199555308_1199555320 25 Left 1199555308 X:149101757-149101779 CCTCCCACGCTCTCTCTCTGATT No data
Right 1199555320 X:149101805-149101827 CTTGCAAGCCTGAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199555308 Original CRISPR AATCAGAGAGAGAGCGTGGG AGG (reversed) Intergenic
No off target data available for this crispr