ID: 1199556425

View in Genome Browser
Species Human (GRCh38)
Location X:149114136-149114158
Sequence GGCTGGGTCCAGCACCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199556425_1199556436 21 Left 1199556425 X:149114136-149114158 CCCAGCAGGTGCTGGACCCAGCC No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556425_1199556429 -4 Left 1199556425 X:149114136-149114158 CCCAGCAGGTGCTGGACCCAGCC No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data
1199556425_1199556437 22 Left 1199556425 X:149114136-149114158 CCCAGCAGGTGCTGGACCCAGCC No data
Right 1199556437 X:149114181-149114203 CTGGCCTGCACACTGAGTGTGGG No data
1199556425_1199556432 3 Left 1199556425 X:149114136-149114158 CCCAGCAGGTGCTGGACCCAGCC No data
Right 1199556432 X:149114162-149114184 AATCAAGCCCAGCAGGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199556425 Original CRISPR GGCTGGGTCCAGCACCTGCT GGG (reversed) Intergenic
No off target data available for this crispr