ID: 1199556428

View in Genome Browser
Species Human (GRCh38)
Location X:149114153-149114175
Sequence TGCTGGGCTTGATTGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 4, 1: 15, 2: 16, 3: 30, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199556428_1199556436 4 Left 1199556428 X:149114153-149114175 CCAGCCTCCAATCAAGCCCAGCA 0: 4
1: 15
2: 16
3: 30
4: 387
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556428_1199556440 28 Left 1199556428 X:149114153-149114175 CCAGCCTCCAATCAAGCCCAGCA 0: 4
1: 15
2: 16
3: 30
4: 387
Right 1199556440 X:149114204-149114226 CCCGCTGAGCCCAGCCCACCAGG No data
1199556428_1199556437 5 Left 1199556428 X:149114153-149114175 CCAGCCTCCAATCAAGCCCAGCA 0: 4
1: 15
2: 16
3: 30
4: 387
Right 1199556437 X:149114181-149114203 CTGGCCTGCACACTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199556428 Original CRISPR TGCTGGGCTTGATTGGAGGC TGG (reversed) Intergenic
900294696 1:1943022-1943044 TGCTGGGCCCCATGGGAGGCGGG + Intronic
900433176 1:2612404-2612426 TGCTGGGCTTGAATGGGGGGCGG + Intronic
900523391 1:3116841-3116863 TGGAGGGCCTGACTGGAGGCAGG - Intronic
900825562 1:4923950-4923972 TGGTGTGCTTGATGGGAGCCTGG - Intergenic
902683453 1:18059952-18059974 TATTGGGCTTGCTAGGAGGCAGG - Intergenic
903402028 1:23060769-23060791 TGCTAGGCTTGATTGTAGGTTGG + Intronic
903828072 1:26159346-26159368 TTCTGGGCTAGCCTGGAGGCCGG - Intronic
904211995 1:28891942-28891964 AGCTGGGCATGGTTGGTGGCAGG + Intronic
907521442 1:55025916-55025938 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
907604313 1:55801651-55801673 TGCTGGGGTGGATTGGAGGGAGG - Intergenic
908852589 1:68389585-68389607 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
909223478 1:72990204-72990226 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
909550850 1:76897163-76897185 TGCTGAGCTTGATGGGTGTCAGG + Intronic
909910146 1:81248760-81248782 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
911510451 1:98803643-98803665 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
918347299 1:183616969-183616991 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
918567487 1:185950688-185950710 TGCTGAGCTTGATGGGTGTCAGG + Intronic
919207000 1:194431235-194431257 TGCTGGGTTTGATCGGAGGCTGG - Intergenic
919946123 1:202320138-202320160 TGCTGGGGTTGATGGCAGGGTGG - Intergenic
921212598 1:212912822-212912844 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
921520318 1:216148865-216148887 TGCTGAGCTTGATGGGTGTCAGG - Intronic
921732795 1:218596191-218596213 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
922763805 1:228147550-228147572 TGCTGGGCAGGGTTGGGGGCTGG + Intronic
922906574 1:229177751-229177773 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
923090498 1:230736885-230736907 TGTTGTTCTTGAGTGGAGGCTGG + Intergenic
923225753 1:231937628-231937650 GGCTGGGCCTGTGTGGAGGCGGG + Intronic
923244932 1:232121500-232121522 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
923257160 1:232232024-232232046 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
923566185 1:235077596-235077618 TGCCTGGCTTGGTTTGAGGCTGG - Intergenic
923975271 1:239255755-239255777 TGCTGGGCTTGATCAGAGGCTGG - Intergenic
1062862305 10:820186-820208 TGCTGGTCTTTAGTGGAGGATGG - Intronic
1063509414 10:6631988-6632010 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1063527500 10:6799488-6799510 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1064138403 10:12770045-12770067 TTGTGGGCCTGACTGGAGGCTGG + Intronic
1065442943 10:25771143-25771165 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1066185788 10:33009237-33009259 TGCTTTGCTTTATTGGAGGATGG - Intergenic
1066997348 10:42576496-42576518 TGCTGGGCATGTTTGCAGGAGGG + Intronic
1067002563 10:42630887-42630909 GGGAGGGCTTGATTGGAGGAAGG - Intronic
1067552100 10:47243488-47243510 TCATGGGCTTGAAAGGAGGCAGG - Intergenic
1068058169 10:52036158-52036180 TGCTGAGCTTGATGGGTGTCAGG + Intronic
1068179477 10:53501425-53501447 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1068231151 10:54170073-54170095 TGCTGAGCTTGATGGGTGTCAGG - Intronic
1068592158 10:58863408-58863430 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1068884584 10:62085750-62085772 TCCGAGGTTTGATTGGAGGCAGG - Exonic
1070475103 10:76821895-76821917 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1070585144 10:77759369-77759391 TGGTGGCCTTGATTGGATCCTGG - Intergenic
1071531283 10:86391956-86391978 TCCTGGGCCTGTTGGGAGGCTGG + Intergenic
1071897561 10:90083431-90083453 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1072580447 10:96735534-96735556 TGCTGAGCTTGATGGGCGTCAGG - Intergenic
1073150607 10:101308862-101308884 TGTGGGGCTTGGTTTGAGGCTGG + Intergenic
1075402451 10:122170984-122171006 TGCAGGGCTTGTGAGGAGGCTGG + Intronic
1075797389 10:125130375-125130397 TGCTGAGCCTCTTTGGAGGCAGG + Intronic
1076672487 10:132130974-132130996 TGCGGGGCATGCTTGGGGGCAGG + Intronic
1076905319 10:133358154-133358176 GGCGGGGCTTTATTGGAGGGCGG + Intergenic
1077454788 11:2672033-2672055 TACTGGGCTTGAGTGCAGACCGG - Intronic
1077678892 11:4221667-4221689 TGCTGAGCCTGATTGGTGTCAGG + Intergenic
1077688329 11:4318307-4318329 TGCTGAGCCTGATTGGTGTCAGG + Intergenic
1078094158 11:8286204-8286226 TTCTTGGGTTGGTTGGAGGCTGG + Intergenic
1079347975 11:19669637-19669659 TGCTGAGCTTCATTGCAAGCAGG - Intronic
1079351492 11:19695510-19695532 TCCTGGGATTGATTGGCTGCAGG + Intronic
1080027734 11:27631474-27631496 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1080866645 11:36201151-36201173 TGCTGGTCTTCTTTGAAGGCTGG + Intronic
1081106659 11:39078723-39078745 TGCTGGGCTTGATCAGAGGCTGG + Intergenic
1081714976 11:45243595-45243617 TGGTGAGCTTGATTGAACGCTGG + Exonic
1085204900 11:74725696-74725718 TTCTGGGCTGGAGGGGAGGCTGG + Intronic
1086305828 11:85481573-85481595 TGCTAGGCTTTATTGGGGGTGGG - Intronic
1087314860 11:96591245-96591267 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1087404883 11:97718000-97718022 TGCTGGGCTTGATTACAGGCTGG - Intergenic
1089263448 11:117239665-117239687 TGCTTAGCTTGCTTGGAAGCTGG + Intronic
1089789625 11:120933268-120933290 TTGTGGGCATGTTTGGAGGCAGG - Intronic
1090871782 11:130755908-130755930 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1091886702 12:4021864-4021886 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1092723551 12:11464574-11464596 TGCTGAGCTTGATGGGTGTCAGG + Intronic
1093070983 12:14707264-14707286 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1093267867 12:17024272-17024294 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1093578996 12:20766686-20766708 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1095642689 12:44502746-44502768 TGCTGGGCTTGATCAGAGGCTGG - Intergenic
1095814127 12:46402619-46402641 TTATGGGCTTGTTTGGAGACTGG + Intergenic
1095898798 12:47306432-47306454 TGCTGGGCTTGATCAGAGGCTGG + Intergenic
1096701920 12:53389943-53389965 TGCTGGGTTTTATTGGGGTCAGG + Intronic
1097416875 12:59325611-59325633 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1097547567 12:61023523-61023545 TGATGGGCTTGATCAGAGGCTGG + Intergenic
1098173458 12:67769039-67769061 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1098629239 12:72706671-72706693 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1099762765 12:86942120-86942142 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1100561539 12:95752481-95752503 TGCTGAGCTTGATGGGTGTCAGG - Intronic
1101957221 12:109222378-109222400 TGCTGGGCCTGTTTGGAGAGTGG + Intronic
1101976660 12:109365527-109365549 TGGTGAGCTTGGTTGGAGGCTGG + Intronic
1102026600 12:109717336-109717358 TTCTGGGCTTGCTTGGAGGGAGG + Intronic
1105237173 13:18567994-18568016 TGCTGGGCTTGATCGGAGGCTGG - Intergenic
1105851310 13:24339007-24339029 TGCTGGGCTTGATTGGACGCTGG + Intergenic
1106892432 13:34260440-34260462 TGCTGAACTAGACTGGAGGCAGG + Intergenic
1107075765 13:36319762-36319784 TGCTGAGCTTGATGGGTGTCAGG - Intronic
1107220115 13:37971567-37971589 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1108281874 13:48869509-48869531 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1108409616 13:50133382-50133404 CGCAGGGCTTGGGTGGAGGCTGG - Intronic
1108513175 13:51173185-51173207 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1108814305 13:54270178-54270200 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1108952773 13:56114812-56114834 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1108958229 13:56187628-56187650 TGCTGGGCTTGATCAGAGGCTGG + Intergenic
1109149241 13:58823811-58823833 TGCTGGGCTTTATCAGAGACTGG - Intergenic
1109709485 13:66143724-66143746 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1110887693 13:80658919-80658941 TGCTGGGCTTGATGGGAGGCTGG - Intergenic
1111189722 13:84791409-84791431 TGCTGGGCTGGCTTGAAAGCAGG - Intergenic
1111197556 13:84894780-84894802 TGCTGGGCTTGATCAGAGGCTGG - Intergenic
1111302225 13:86361730-86361752 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1111458662 13:88515223-88515245 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1111631523 13:90850981-90851003 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1112230346 13:97583490-97583512 TCCTGGACTTGGTTGGAAGCAGG + Intergenic
1113952577 13:114080131-114080153 CGCTGGGCTTGGATGGAGCCAGG + Intronic
1115692428 14:35858676-35858698 CTCAAGGCTTGATTGGAGGCTGG + Intronic
1115904989 14:38194113-38194135 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1116179856 14:41519265-41519287 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1117801364 14:59447397-59447419 TGCTGAGCTTGATGGGTGTCAGG - Intronic
1120105872 14:80493778-80493800 TGCTGGGCTTGAATTTAGGTAGG + Intronic
1121493766 14:94378204-94378226 TGCTGGGCTTGAATCCAGGGGGG - Exonic
1121528514 14:94636898-94636920 TCCTGGGCTGGCTTGGAGGCAGG - Intergenic
1121626671 14:95390166-95390188 TGCTGGCATTAAGTGGAGGCAGG + Intergenic
1122041176 14:98988517-98988539 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1122322367 14:100862746-100862768 ATCTGGGTTTCATTGGAGGCTGG - Intergenic
1124023465 15:25944412-25944434 TGCTGGGCTTCATCAGAGGCAGG - Intergenic
1125131335 15:36288031-36288053 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1125764308 15:42123032-42123054 TGCTGGGCTTTCTTAGAGGGAGG + Intergenic
1128724675 15:69979539-69979561 TGCTGGCCATGCTTGCAGGCTGG - Intergenic
1129434192 15:75524858-75524880 TGCTTGACTGGCTTGGAGGCAGG - Intronic
1130909424 15:88260958-88260980 GTCTGGGCCTGGTTGGAGGCTGG + Intergenic
1130945770 15:88549892-88549914 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1131445502 15:92495330-92495352 TGCTGGGCTTGTTTGCAGAATGG - Intronic
1131684884 15:94757790-94757812 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1132034833 15:98473700-98473722 TGCTGGGGTTATTGGGAGGCGGG + Intronic
1132905600 16:2281123-2281145 TGCTGGGCTTCAATGGAGCCGGG - Exonic
1133778682 16:8919377-8919399 TGCTGGGCTTGATCAGTGACAGG - Intronic
1133851007 16:9503496-9503518 TCCTGGGCTTGAATGAAAGCTGG + Intergenic
1133869369 16:9673482-9673504 TGCTGAGCTTGATGGGTGTCAGG + Intronic
1134341999 16:13354958-13354980 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1134801871 16:17091864-17091886 AGCTGGGGTTGAGTGGTGGCAGG + Intergenic
1136186861 16:28593421-28593443 AGGTGGGCTTGATGGGAGGAAGG - Exonic
1136223482 16:28843882-28843904 AGCTGGGCTTGGCTGGAGGCTGG + Intronic
1136293793 16:29290644-29290666 TGCTGAGCTTGAGTTGTGGCTGG - Intergenic
1136317586 16:29463470-29463492 AGGTGGGCTTGACTGGAGGAAGG + Exonic
1136417679 16:30113608-30113630 CGCTGGGCTGGCTTGGAGCCAGG + Exonic
1136432161 16:30202815-30202837 AGGTGGGCTTGACTGGAGGAAGG + Exonic
1136551540 16:30984945-30984967 TGCTGGGCTTCCCAGGAGGCCGG - Exonic
1136685264 16:31990288-31990310 TGGTGGGCTTGATTGGGCTCTGG + Intergenic
1136785877 16:32933823-32933845 TGGTGGGCTTGATTGGGCTCTGG + Intergenic
1136883894 16:33919981-33920003 TGGTGGGCTTGATTGGGCTCTGG - Intergenic
1137472774 16:48776819-48776841 TGGTGGGCTGGATTGGTGCCTGG + Intergenic
1138121582 16:54404630-54404652 TGCTGGGATAGAGAGGAGGCAGG - Intergenic
1138293671 16:55868986-55869008 TGTTAGGCCTGATTGGAGGAGGG + Intronic
1138422702 16:56909982-56910004 TGCTGGGCTTTTTATGAGGCTGG - Intronic
1138805131 16:60082150-60082172 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1139225735 16:65232222-65232244 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1139248020 16:65466656-65466678 TGATGGTATTGAGTGGAGGCAGG + Intergenic
1139631717 16:68235566-68235588 TTCTGGGCGGGATTGGCGGCCGG - Intronic
1139656279 16:68389011-68389033 TGCTGAGCAGGGTTGGAGGCAGG - Intronic
1139699050 16:68695950-68695972 TGCTGGGCTTGAATAAAGGGTGG - Intronic
1139942876 16:70618863-70618885 TGCTGAGCTTGATGGGGGTCAGG + Intronic
1140067553 16:71624634-71624656 TGGTGGGCATGAATTGAGGCTGG - Intergenic
1141865022 16:86744424-86744446 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1203088114 16_KI270728v1_random:1195485-1195507 TGGTGGGCTTGATTGGGCTCTGG + Intergenic
1144301651 17:13926933-13926955 TGCTGCGATTGCCTGGAGGCAGG - Intergenic
1144699242 17:17326003-17326025 TGCTGGGCTTGACAGTGGGCAGG - Intronic
1146366205 17:32230321-32230343 TGCTGGGATTGATTACAGGCGGG + Intronic
1147146209 17:38485969-38485991 TGGTGGGCTTGATTGGGCTCTGG + Intronic
1147183754 17:38702912-38702934 GGCTGGGCTGGATTCGTGGCGGG - Intergenic
1148644290 17:49210456-49210478 TGCTGGGTGGGATTGGGGGCTGG + Exonic
1149531703 17:57400791-57400813 AGCTGGGCTTGACTGGGTGCAGG + Intronic
1150284454 17:63947208-63947230 GCCTGGGCTTGAGGGGAGGCTGG - Intronic
1151817802 17:76479705-76479727 TGCTGGGCTTGGGTGTAGGGGGG + Intronic
1152087884 17:78231618-78231640 TGCAGGGCTTGAGAGGAGGAGGG - Exonic
1152241251 17:79162414-79162436 TGGTGGGCCTGGCTGGAGGCAGG - Intronic
1153953199 18:10074338-10074360 TGCAGGGCTGGTTTGGAAGCAGG + Intergenic
1156473437 18:37391421-37391443 TGCTGGGTCTGAATGCAGGCTGG + Intronic
1157741377 18:50096437-50096459 TGGTGGGATGGATTGGAGGGGGG - Intronic
1158336552 18:56418913-56418935 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1159835227 18:73327959-73327981 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1160897557 19:1409770-1409792 TGCTGAGCTTGGATGGAAGCAGG + Intronic
1161494671 19:4580730-4580752 TTCTGGGCTGGACAGGAGGCCGG + Intergenic
1161621255 19:5298561-5298583 TGCTGTGCTAGGTAGGAGGCGGG - Intronic
1162124914 19:8494258-8494280 TTCTGGGAGTGGTTGGAGGCAGG + Intronic
1163628627 19:18405046-18405068 TGATGGGGTTGAATTGAGGCGGG - Intergenic
1163907360 19:20158856-20158878 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1165341700 19:35216991-35217013 TACTGTGCTAGTTTGGAGGCTGG + Intergenic
1165387586 19:35520025-35520047 TGCTGGGTTTGCTTGGATGGGGG - Intergenic
1165835540 19:38752929-38752951 TGCTGAGCCTGATTGGTGTCAGG - Intronic
1165898759 19:39158611-39158633 TGCTGGGCCAGATTCGGGGCAGG + Intronic
1167043970 19:47039377-47039399 TGGTGGGCATGGTTGGAGGAGGG - Intronic
1167253597 19:48414621-48414643 TACTGGGCTTCACGGGAGGCGGG - Intronic
1168211948 19:54897289-54897311 TGCTGAGCTTGATCGGTGTCAGG + Intergenic
1168373433 19:55855623-55855645 TACTGGATTTGATTGGATGCAGG - Intronic
926083375 2:10006433-10006455 TGCTGGGCTTGATTGGAGGCTGG - Intergenic
926407942 2:12573075-12573097 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
927889359 2:26738739-26738761 TGCTGAGGTTGCTGGGAGGCAGG + Intergenic
929004659 2:37383390-37383412 TGCTGAGCCTGATGGGAGTCAGG + Intergenic
931625959 2:64255851-64255873 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
932587812 2:73043166-73043188 TGCTGGGCTTCCTTGGTGTCTGG - Intronic
932817726 2:74874996-74875018 TCCTGGGATGGATTGGAGGAGGG + Intronic
932854031 2:75216164-75216186 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
932973776 2:76576241-76576263 TGCTGAGCTTGATGGGAGTCAGG + Intergenic
933003938 2:76965932-76965954 TGTAGGGGTTGATTGGAGCCAGG + Intronic
933013267 2:77091690-77091712 TGCTGAGCTTGATGGGTGTCAGG - Intronic
933079445 2:77968423-77968445 TGCTGAGCTTGATCGGTGTCAGG - Intergenic
933111550 2:78408048-78408070 TGCTGGGCCTGCCTGGGGGCAGG + Intergenic
933654785 2:84878737-84878759 TGCTGCACTGGATTGGAGGCTGG + Intronic
936883510 2:117282055-117282077 TGCTGAGCTTGATGGGTGACAGG - Intergenic
937326049 2:120990027-120990049 GGCTGGGCTCGAGGGGAGGCCGG - Exonic
938315938 2:130327984-130328006 TGCTGGGCTTGATTGGAGGACGG + Intergenic
938512602 2:131966519-131966541 TGCTGGGCTTGATCGGAGGCTGG + Intergenic
938583639 2:132669603-132669625 AGCTGGGCTTGAGAGGAGGGAGG - Intronic
939037065 2:137145391-137145413 TACTGGGCCTGATTGGAGGCAGG + Intronic
940364288 2:152829601-152829623 TGCTGAGCTTGATGTAAGGCTGG + Intergenic
940881832 2:158954359-158954381 TGCTGGGCTTTTTTGGGGGGGGG + Intergenic
942185931 2:173425287-173425309 AGCTGCTCTTGCTTGGAGGCAGG + Intergenic
942730112 2:179054151-179054173 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
944875943 2:203964308-203964330 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
945152922 2:206809251-206809273 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
945376282 2:209081391-209081413 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
945394473 2:209302525-209302547 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
945938503 2:215925695-215925717 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
946374549 2:219300153-219300175 TGCTGGACTTCACTGGAGGTAGG + Exonic
948545152 2:238722964-238722986 GGCTGGGTTTGACTGGAAGCTGG - Intergenic
948809315 2:240466729-240466751 TGCGGGGCTTCTCTGGAGGCTGG - Exonic
1169302136 20:4452391-4452413 TTCTGGGGTTGATTGTATGCAGG + Intergenic
1170068691 20:12342664-12342686 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1170106411 20:12757195-12757217 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1170165920 20:13360267-13360289 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1171966777 20:31536469-31536491 TGCAGGGCTAGAGTGGAAGCAGG - Intronic
1172038073 20:32024288-32024310 AGCTGTGCTTGTTGGGAGGCTGG + Intronic
1172231576 20:33340231-33340253 TGCTGAGCCTGCTTGAAGGCAGG + Intergenic
1175268408 20:57716579-57716601 TGCTGGGTTTGAGGGGAAGCAGG + Intergenic
1176261140 20:64181185-64181207 TGCCGGGCTTGGTTGGATGTGGG + Intronic
1176388919 21:6153703-6153725 TGCTGGGCATGATTCCAGCCAGG + Intergenic
1176781160 21:13196276-13196298 TGCTGGGCTTGATCGGAGGCTGG - Intergenic
1177978853 21:27885426-27885448 TGCTGGGCTTGATCGGAGGCTGG - Intergenic
1178705199 21:34867545-34867567 TGCTGGGCTCAACTGCAGGCAGG + Intronic
1179734553 21:43384545-43384567 TGCTGGGCATGATTCCAGCCAGG - Intergenic
1180199822 21:46217633-46217655 TGCTGGAGTTGCTTGGAGGGTGG - Intronic
1180744450 22:18078178-18078200 AGCTGGGCTCGCCTGGAGGCTGG - Intronic
1180945519 22:19690397-19690419 TGTGGGGCTTGTTTGGATGCTGG + Intergenic
1181508252 22:23376256-23376278 TGTTAGGCATGATTGGAGGAGGG + Intergenic
1182150336 22:28023060-28023082 TCCTGGGCTTGAGAGGAGCCAGG - Intronic
1183020260 22:35021087-35021109 TGCTGGGCTTGAGGGGATGCTGG - Intergenic
1183698323 22:39435796-39435818 TCCTTGGCTTGATAGGAGGTGGG + Intronic
950269431 3:11601924-11601946 TGCTGGGGCTGATTGGGGGAGGG + Exonic
950457688 3:13102419-13102441 TGGGGGGCTGGATTAGAGGCTGG + Intergenic
952195982 3:31075818-31075840 TGCAGGGCTTCAAGGGAGGCAGG - Intergenic
952744457 3:36764238-36764260 TGCGGGGCTGGAGTGGCGGCGGG + Intergenic
953582936 3:44173369-44173391 TGCTGGGCTTGATTGAAGGCTGG - Intergenic
955390916 3:58521653-58521675 TGCTGAGTTTGTTTGGAGGTGGG - Intronic
956487746 3:69739979-69740001 TGCTGAGACTGATTGGGGGCTGG + Intronic
956610825 3:71121231-71121253 TCCTGGGCTTGATTGGCGGTGGG - Intronic
956848953 3:73210833-73210855 TGCTGGACTTTATTGGATCCCGG + Intergenic
956953507 3:74310442-74310464 TGGGGGGCTTGATTGGAAACTGG + Intronic
957059740 3:75472467-75472489 TGCTGAGCTTGATTGGTGTCAGG + Intergenic
957317129 3:78585535-78585557 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
958866326 3:99505903-99505925 GGCTGGCCTTGATTGGAACCAGG + Intergenic
959972085 3:112419952-112419974 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
960385967 3:117022373-117022395 TGCTGGACCTGAATGGATGCAGG + Intronic
961440844 3:126952389-126952411 TGCTGGGCTGCATGGCAGGCAGG + Intronic
961700433 3:128740108-128740130 TGATGGGATTGATTGCAGGCGGG - Intronic
962456329 3:135568609-135568631 TCCCGGGCTGGATTGGGGGCTGG - Intergenic
963684506 3:148417667-148417689 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
964969012 3:162536916-162536938 TAATGGGCTAGATTAGAGGCAGG + Intergenic
965262478 3:166503173-166503195 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
965336508 3:167434538-167434560 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
965390367 3:168096017-168096039 TGCCGGGCTCGATTGGATGCCGG + Intergenic
966104920 3:176324031-176324053 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
966232676 3:177668243-177668265 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
967211984 3:187177920-187177942 TGCTGAGCTTGATGGGTGTCAGG + Intronic
967561558 3:190923428-190923450 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
967624474 3:191668875-191668897 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
968710066 4:2108102-2108124 AGCTGGGATTGCTTGGAGTCAGG - Intronic
969981546 4:11161797-11161819 TGCTGGGCTTGAGTGGCAGGAGG - Intergenic
970256236 4:14172914-14172936 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
970532915 4:17000982-17001004 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
970759485 4:19467143-19467165 AGATGGGCTAGTTTGGAGGCAGG + Intergenic
971123007 4:23724415-23724437 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
971200313 4:24504330-24504352 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
971798562 4:31259362-31259384 TGCTGGGCTTGATCAGAGGCTGG + Intergenic
972123251 4:35732100-35732122 TCCTGGGATAGAATGGAGGCAGG + Intergenic
974172611 4:58286016-58286038 AGCTGAGCTTGATGGGAGTCAGG - Intergenic
975864914 4:78716251-78716273 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
975921413 4:79394689-79394711 GGCTGGGCTTGATTGTGTGCTGG + Intergenic
975933711 4:79556368-79556390 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
976696718 4:87925183-87925205 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
977010490 4:91627399-91627421 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
977012751 4:91657013-91657035 TGCTGAGCTTGATGGGCGTCAGG + Intergenic
977198254 4:94087023-94087045 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
978000945 4:103556154-103556176 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
979850130 4:125564024-125564046 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
979852323 4:125588353-125588375 TCCTGGGCTGCAATGGAGGCCGG - Intergenic
979894988 4:126147536-126147558 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
980111741 4:128643258-128643280 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
980765351 4:137296185-137296207 TGGTGGGCTTGATAGAAGGCAGG + Intergenic
982180303 4:152743724-152743746 TGCTGAGCTTGATGGGTGTCAGG + Intronic
982263614 4:153518123-153518145 TGCCGGGCTTGATTCCAGCCAGG + Intronic
982293800 4:153806346-153806368 TGCTGGGCTTGATCGAAGGCTGG + Intergenic
982535619 4:156603600-156603622 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
983055658 4:163096387-163096409 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
983345731 4:166523843-166523865 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
983360587 4:166719623-166719645 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
983414539 4:167438201-167438223 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
983957809 4:173717712-173717734 TGCTGGACTTGATGGGGGACAGG - Intergenic
984354188 4:178637194-178637216 TGCTGGGCTTCGTTGGGGGTGGG - Intergenic
986389054 5:7266904-7266926 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
986919409 5:12664931-12664953 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
987282177 5:16423037-16423059 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
987487014 5:18536993-18537015 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
987497949 5:18671249-18671271 TGCTGAGCTTGATGGGTGCCAGG + Intergenic
988605200 5:32673340-32673362 TGCTGTGATTGATTGGAGGCTGG - Intergenic
988605942 5:32678523-32678545 TGCTAGGCTTGATCAGAGGCTGG - Intergenic
992277028 5:75131028-75131050 TGCTGGGCTTGATAGGAGGCTGG - Intronic
992394843 5:76360674-76360696 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
993836870 5:92827278-92827300 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
994778775 5:104066593-104066615 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
994989725 5:106981682-106981704 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
996203081 5:120699980-120700002 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
996221404 5:120936965-120936987 TGCTGGGCTTGATCAGAGGTTGG + Intergenic
996344645 5:122475995-122476017 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
996459975 5:123730967-123730989 TGCAGGGCTAGATGGGAGGTGGG + Intergenic
996679966 5:126221031-126221053 TGCTGGGCTTGATCAGTGGCTGG + Intergenic
996681177 5:126229214-126229236 TGCTGGGATTGATCAGAGTCTGG + Intergenic
996745261 5:126841946-126841968 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
997738862 5:136236194-136236216 TACTGGGCTTGCTTGTAGACTGG - Intronic
997772477 5:136567742-136567764 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
997879753 5:137579122-137579144 TGTTTGGCCAGATTGGAGGCTGG - Intronic
998576404 5:143322460-143322482 TGCAGGTCATGATTGGAGGCAGG - Intronic
998691751 5:144595238-144595260 TGCTGGGCCTGATCAGAGACTGG + Intergenic
998876453 5:146605011-146605033 TGCTGGGCTGGAATCCAGGCTGG + Intronic
1000148444 5:158476041-158476063 TGCTGGGTCTGATTGGAAGTGGG + Intergenic
1000758397 5:165189515-165189537 GTCTGGGATTGGTTGGAGGCGGG + Intergenic
1002138969 5:177127023-177127045 TGCTTGGCTTGATATGAAGCTGG + Intergenic
1002323335 5:178388703-178388725 GGCTGGGCTGGGCTGGAGGCAGG - Intronic
1003907978 6:10720157-10720179 TGCTGGGCTTGATCGGAGGCTGG - Intergenic
1004196801 6:13512596-13512618 TACTGGGTTTGATCAGAGGCTGG + Intergenic
1004606600 6:17200730-17200752 TGCTGGGCTTGATTGGAGGCTGG + Intergenic
1005014476 6:21363902-21363924 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1005935548 6:30518079-30518101 TGCTGGGCTTGATGGGGGGGTGG + Intergenic
1006682224 6:35805407-35805429 TGGTGGGCTTGGGAGGAGGCAGG + Exonic
1006907875 6:37545285-37545307 TTGAGGGCTTGAGTGGAGGCCGG + Intergenic
1007900796 6:45410245-45410267 AGATGGGCATGAATGGAGGCAGG + Intronic
1009971271 6:70627949-70627971 TGCTGGGCTTGGTCGGGGGTAGG - Intergenic
1010586516 6:77662946-77662968 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1011770769 6:90672606-90672628 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1012014214 6:93832469-93832491 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1012066365 6:94556335-94556357 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1012315995 6:97782900-97782922 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1012675269 6:102105270-102105292 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1013391619 6:109691251-109691273 GGCGGGGCTTGCCTGGAGGCGGG + Intergenic
1013683255 6:112548212-112548234 TGCTAGGCTTTTTTGGGGGCTGG + Intergenic
1013891888 6:115035199-115035221 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1014105813 6:117559276-117559298 AGCTGGAGTTGATTGGAGGCTGG + Intronic
1014454692 6:121622830-121622852 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1014793813 6:125704256-125704278 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1014891721 6:126852063-126852085 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1015266921 6:131298767-131298789 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1015271548 6:131342186-131342208 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1015287873 6:131506736-131506758 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1015324005 6:131905002-131905024 TGCTGGGCTTGATGGGTGTCAGG - Intergenic
1015688797 6:135896949-135896971 TGCTAAGCTTGATTGGAGAGTGG - Intronic
1016204706 6:141456131-141456153 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1016206529 6:141473812-141473834 TCTTTGGCTTGATTGGAGGTGGG + Intergenic
1016249040 6:142019125-142019147 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1016538735 6:145138845-145138867 TGCAGGGCCTCATTGGAAGCAGG - Intergenic
1017211411 6:151861234-151861256 TGCTTGGCTTGTTTGGAAGCAGG - Intronic
1017788215 6:157773759-157773781 TGCTGAGTTGGATTGGAGGAGGG + Intronic
1019165449 6:170095112-170095134 TCCTGGGCTGGAGGGGAGGCAGG + Intergenic
1019572724 7:1720442-1720464 TGCTGTGCCTGGGTGGAGGCTGG - Intronic
1019713389 7:2527455-2527477 TGCAGGGCCTGCTTGGAGGAAGG + Exonic
1021006166 7:15397254-15397276 TGCTGGGCTTGATCAGGGTCTGG - Intronic
1021810828 7:24399595-24399617 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1021977729 7:26026588-26026610 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1022519042 7:30994272-30994294 TGCTGGGCTTCATAGGAGGCTGG - Intergenic
1022578001 7:31517567-31517589 TGCTGGGCTTGATCGGAGGCTGG - Intronic
1023698712 7:42873008-42873030 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1025033309 7:55574334-55574356 TGCTTGGCATGGTTGGAGGATGG + Intergenic
1027516488 7:79148189-79148211 TGCTGGGCTGGATTGGAGCGAGG + Intronic
1027659745 7:80975011-80975033 TGCTGGGCTTGATCAGAGGCTGG - Intergenic
1027946311 7:84749484-84749506 TACTGGGCTTGCCTGGAGCCTGG - Intergenic
1029661426 7:101964789-101964811 CGCTGGCCTTAATTGGAGGATGG + Intronic
1031024417 7:116664555-116664577 AGCAGGGCGAGATTGGAGGCAGG - Intergenic
1031087080 7:117313115-117313137 GCCTGGGCTTGTTTGAAGGCAGG - Intronic
1031400157 7:121318871-121318893 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1031727768 7:125261301-125261323 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1031987638 7:128173532-128173554 GGCTGGGCTGGGTTGGGGGCTGG - Intergenic
1033419408 7:141193077-141193099 GGCAGGGCTTGACTGGAGGATGG - Intronic
1033464864 7:141581219-141581241 TGCTGGGCCTGATGGGTGTCAGG + Intronic
1034710075 7:153183607-153183629 TCCTGGGCCTGATTTGAAGCAGG + Intergenic
1035356588 7:158279583-158279605 TGCTGGGCTTGATTGGAGGCTGG - Intronic
1036372283 8:8171877-8171899 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1036878619 8:12493764-12493786 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1038568203 8:28637333-28637355 TGCTGGGAGTGATGGGAGCCTGG - Intronic
1038726705 8:30088261-30088283 TGCTGGGCTTGATCAGAGGCTGG + Intergenic
1042707551 8:71678229-71678251 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1043224060 8:77700835-77700857 TGCTGGGCTTGATCGGAGGCTGG + Intergenic
1043353490 8:79388497-79388519 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1044925335 8:97204234-97204256 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1045197704 8:99947189-99947211 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1045362948 8:101449761-101449783 TGCTGGGATGGCTTGGAGGCTGG - Intergenic
1045560131 8:103253890-103253912 TGCTGGGCTTCAAGGGAGCCTGG + Intergenic
1045644959 8:104289251-104289273 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1046440190 8:114244656-114244678 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1047421490 8:124711497-124711519 GGCTGGGCTGGGCTGGAGGCTGG - Intronic
1047829372 8:128614309-128614331 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1048010149 8:130448849-130448871 GGCTGGGCTTGAGTGGGGGTGGG + Intergenic
1048143938 8:131822507-131822529 TGCTGGGCCTGATGGGTGTCAGG - Intergenic
1048301913 8:133257830-133257852 TGCTGGGCTTTGCTGGAGGTTGG - Intronic
1048728249 8:137410669-137410691 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1048914903 8:139173161-139173183 TGCTGGTCTTGATTATATGCAGG - Intergenic
1049235202 8:141508707-141508729 TGCTGGGCTTGACTGGGCGGCGG + Intergenic
1051968863 9:22863223-22863245 TGCTGGGCTTGATCGGAGGCTGG - Intergenic
1052990820 9:34518523-34518545 TGGTGGGCTTGAGGGGAGGGAGG + Intronic
1053434001 9:38063271-38063293 TGTAGGGCTTGATTGAAGCCGGG - Intronic
1055810230 9:80140730-80140752 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1056061332 9:82887065-82887087 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1056324069 9:85461962-85461984 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1056522623 9:87414241-87414263 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1056883153 9:90415892-90415914 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1057235022 9:93350925-93350947 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1057684175 9:97218151-97218173 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1058172348 9:101697608-101697630 TACTGGGCTTCAGTGGATGCAGG - Intronic
1058733743 9:107875428-107875450 TGCTAGGCTTGGCTGGAGTCTGG - Intergenic
1059606527 9:115841595-115841617 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1059863315 9:118488064-118488086 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1060226386 9:121793644-121793666 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1060948605 9:127586335-127586357 TGCTGGGGTCGAGTGGAGGCAGG + Intergenic
1061630980 9:131872034-131872056 TCCTGGGCCGGAGTGGAGGCTGG + Intronic
1188078254 X:25805892-25805914 TGCTGGGTTTGATTGGAGGCAGG - Intergenic
1189349554 X:40266608-40266630 TGATGGGCTGGAGTGGAGCCTGG - Intergenic
1189585894 X:42461313-42461335 AGCTGGGGTTGATGGGAGGATGG - Intergenic
1189753683 X:44249196-44249218 TACTGCGTTTGCTTGGAGGCAGG - Intronic
1189971148 X:46419596-46419618 AGCTGGGGTTGATTTGAGTCAGG - Intergenic
1190970394 X:55342573-55342595 TGGTGGGCATTATTGGCGGCGGG - Intergenic
1191934739 X:66414633-66414655 TGCTGGGCTTGGCTAGGGGCTGG - Intergenic
1193537249 X:82730154-82730176 TGCTGGGCCTGATGGGTGTCAGG - Intergenic
1193941673 X:87685210-87685232 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1194502805 X:94701215-94701237 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1194822596 X:98526660-98526682 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1196073261 X:111547239-111547261 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1196165721 X:112533932-112533954 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1196331000 X:114470079-114470101 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1196533374 X:116814879-116814901 TGCTGAGCTTGATGGGTGTCAGG + Intergenic
1197065087 X:122225352-122225374 TGCTGAGCTTGATGGGTGTCAGG - Intergenic
1197082792 X:122439778-122439800 GCCTGGGCTTGAGTGGAGGATGG - Intergenic
1198098445 X:133403052-133403074 TTCTTGGCTTGCTTGGAGGTGGG - Intronic
1198428690 X:136544799-136544821 TTCAGGGCTGGTTTGGAGGCTGG - Intronic
1198741878 X:139851211-139851233 TGCTGGGCTGGAATGCAGGGAGG - Intronic
1199443689 X:147897225-147897247 TGTTGGGCTTGATCGGAGGCTGG - Intergenic
1199556419 X:149114120-149114142 TGCTGGGCTTGATGGGAGGCTGG - Intergenic
1199556428 X:149114153-149114175 TGCTGGGCTTGATTGGAGGCTGG - Intergenic
1199993373 X:153002885-153002907 TGCTTGGGCTGATGGGAGGCTGG + Intergenic
1201187278 Y:11416510-11416532 TGCTTGGCTTAGTTGGAGGAGGG + Intergenic