ID: 1199556429

View in Genome Browser
Species Human (GRCh38)
Location X:149114155-149114177
Sequence AGCCTCCAATCAAGCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199556426_1199556429 -5 Left 1199556426 X:149114137-149114159 CCAGCAGGTGCTGGACCCAGCCT No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data
1199556418_1199556429 13 Left 1199556418 X:149114119-149114141 CCCAGCCTCCCATCAAGCCCAGC No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data
1199556421_1199556429 8 Left 1199556421 X:149114124-149114146 CCTCCCATCAAGCCCAGCAGGTG No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data
1199556423_1199556429 4 Left 1199556423 X:149114128-149114150 CCATCAAGCCCAGCAGGTGCTGG No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data
1199556419_1199556429 12 Left 1199556419 X:149114120-149114142 CCAGCCTCCCATCAAGCCCAGCA No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data
1199556425_1199556429 -4 Left 1199556425 X:149114136-149114158 CCCAGCAGGTGCTGGACCCAGCC No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data
1199556422_1199556429 5 Left 1199556422 X:149114127-149114149 CCCATCAAGCCCAGCAGGTGCTG No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data
1199556417_1199556429 25 Left 1199556417 X:149114107-149114129 CCACACACAGGACCCAGCCTCCC No data
Right 1199556429 X:149114155-149114177 AGCCTCCAATCAAGCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199556429 Original CRISPR AGCCTCCAATCAAGCCCAGC AGG Intergenic
No off target data available for this crispr