ID: 1199556430

View in Genome Browser
Species Human (GRCh38)
Location X:149114157-149114179
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199556430_1199556436 0 Left 1199556430 X:149114157-149114179 CCTCCAATCAAGCCCAGCAGGCG No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556430_1199556437 1 Left 1199556430 X:149114157-149114179 CCTCCAATCAAGCCCAGCAGGCG No data
Right 1199556437 X:149114181-149114203 CTGGCCTGCACACTGAGTGTGGG No data
1199556430_1199556440 24 Left 1199556430 X:149114157-149114179 CCTCCAATCAAGCCCAGCAGGCG No data
Right 1199556440 X:149114204-149114226 CCCGCTGAGCCCAGCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199556430 Original CRISPR CGCCTGCTGGGCTTGATTGG AGG (reversed) Intergenic
No off target data available for this crispr