ID: 1199556436

View in Genome Browser
Species Human (GRCh38)
Location X:149114180-149114202
Sequence CCTGGCCTGCACACTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199556430_1199556436 0 Left 1199556430 X:149114157-149114179 CCTCCAATCAAGCCCAGCAGGCG No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556431_1199556436 -3 Left 1199556431 X:149114160-149114182 CCAATCAAGCCCAGCAGGCGCCT No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556426_1199556436 20 Left 1199556426 X:149114137-149114159 CCAGCAGGTGCTGGACCCAGCCT No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556425_1199556436 21 Left 1199556425 X:149114136-149114158 CCCAGCAGGTGCTGGACCCAGCC No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556423_1199556436 29 Left 1199556423 X:149114128-149114150 CCATCAAGCCCAGCAGGTGCTGG No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556422_1199556436 30 Left 1199556422 X:149114127-149114149 CCCATCAAGCCCAGCAGGTGCTG No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556428_1199556436 4 Left 1199556428 X:149114153-149114175 CCAGCCTCCAATCAAGCCCAGCA 0: 4
1: 15
2: 16
3: 30
4: 387
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data
1199556427_1199556436 5 Left 1199556427 X:149114152-149114174 CCCAGCCTCCAATCAAGCCCAGC No data
Right 1199556436 X:149114180-149114202 CCTGGCCTGCACACTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199556436 Original CRISPR CCTGGCCTGCACACTGAGTG TGG Intergenic
No off target data available for this crispr