ID: 1199561899

View in Genome Browser
Species Human (GRCh38)
Location X:149172194-149172216
Sequence GGGCATGATAATGCAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199561896_1199561899 -7 Left 1199561896 X:149172178-149172200 CCATGTCTCACATCCAGGGCATG 0: 80
1: 680
2: 1151
3: 1653
4: 1611
Right 1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG No data
1199561893_1199561899 2 Left 1199561893 X:149172169-149172191 CCTTTGACTCCATGTCTCACATC 0: 1251
1: 1968
2: 1560
3: 958
4: 671
Right 1199561899 X:149172194-149172216 GGGCATGATAATGCAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199561899 Original CRISPR GGGCATGATAATGCAAATGG TGG Intergenic
No off target data available for this crispr