ID: 1199563276

View in Genome Browser
Species Human (GRCh38)
Location X:149186930-149186952
Sequence CATAGTTTCAAGCAGTCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199563273_1199563276 4 Left 1199563273 X:149186903-149186925 CCAGAGTAATCCTGAAAAGACGG No data
Right 1199563276 X:149186930-149186952 CATAGTTTCAAGCAGTCCAATGG No data
1199563271_1199563276 25 Left 1199563271 X:149186882-149186904 CCACCATTGAATGAGAATGGTCC No data
Right 1199563276 X:149186930-149186952 CATAGTTTCAAGCAGTCCAATGG No data
1199563272_1199563276 22 Left 1199563272 X:149186885-149186907 CCATTGAATGAGAATGGTCCAGA No data
Right 1199563276 X:149186930-149186952 CATAGTTTCAAGCAGTCCAATGG No data
1199563269_1199563276 27 Left 1199563269 X:149186880-149186902 CCCCACCATTGAATGAGAATGGT No data
Right 1199563276 X:149186930-149186952 CATAGTTTCAAGCAGTCCAATGG No data
1199563275_1199563276 -6 Left 1199563275 X:149186913-149186935 CCTGAAAAGACGGAATACATAGT No data
Right 1199563276 X:149186930-149186952 CATAGTTTCAAGCAGTCCAATGG No data
1199563270_1199563276 26 Left 1199563270 X:149186881-149186903 CCCACCATTGAATGAGAATGGTC No data
Right 1199563276 X:149186930-149186952 CATAGTTTCAAGCAGTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199563276 Original CRISPR CATAGTTTCAAGCAGTCCAA TGG Intergenic
No off target data available for this crispr