ID: 1199565460

View in Genome Browser
Species Human (GRCh38)
Location X:149211156-149211178
Sequence CTGTGTTTAGTTAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199565460_1199565467 12 Left 1199565460 X:149211156-149211178 CCCCCTTCCCTAACTAAACACAG No data
Right 1199565467 X:149211191-149211213 AATGAGCCAAGAACAGCTGAGGG No data
1199565460_1199565466 11 Left 1199565460 X:149211156-149211178 CCCCCTTCCCTAACTAAACACAG No data
Right 1199565466 X:149211190-149211212 TAATGAGCCAAGAACAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199565460 Original CRISPR CTGTGTTTAGTTAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr