ID: 1199565466

View in Genome Browser
Species Human (GRCh38)
Location X:149211190-149211212
Sequence TAATGAGCCAAGAACAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199565462_1199565466 9 Left 1199565462 X:149211158-149211180 CCCTTCCCTAACTAAACACAGAA No data
Right 1199565466 X:149211190-149211212 TAATGAGCCAAGAACAGCTGAGG No data
1199565465_1199565466 3 Left 1199565465 X:149211164-149211186 CCTAACTAAACACAGAAGAAAGA No data
Right 1199565466 X:149211190-149211212 TAATGAGCCAAGAACAGCTGAGG No data
1199565464_1199565466 4 Left 1199565464 X:149211163-149211185 CCCTAACTAAACACAGAAGAAAG No data
Right 1199565466 X:149211190-149211212 TAATGAGCCAAGAACAGCTGAGG No data
1199565460_1199565466 11 Left 1199565460 X:149211156-149211178 CCCCCTTCCCTAACTAAACACAG No data
Right 1199565466 X:149211190-149211212 TAATGAGCCAAGAACAGCTGAGG No data
1199565463_1199565466 8 Left 1199565463 X:149211159-149211181 CCTTCCCTAACTAAACACAGAAG No data
Right 1199565466 X:149211190-149211212 TAATGAGCCAAGAACAGCTGAGG No data
1199565461_1199565466 10 Left 1199565461 X:149211157-149211179 CCCCTTCCCTAACTAAACACAGA No data
Right 1199565466 X:149211190-149211212 TAATGAGCCAAGAACAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199565466 Original CRISPR TAATGAGCCAAGAACAGCTG AGG Intergenic
No off target data available for this crispr