ID: 1199567633

View in Genome Browser
Species Human (GRCh38)
Location X:149232056-149232078
Sequence TAAGCATCCTACATCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199567633_1199567636 -7 Left 1199567633 X:149232056-149232078 CCATGCAGGATGTAGGATGCTTA No data
Right 1199567636 X:149232072-149232094 ATGCTTATGACACATCCAAGGGG No data
1199567633_1199567634 -9 Left 1199567633 X:149232056-149232078 CCATGCAGGATGTAGGATGCTTA No data
Right 1199567634 X:149232070-149232092 GGATGCTTATGACACATCCAAGG No data
1199567633_1199567635 -8 Left 1199567633 X:149232056-149232078 CCATGCAGGATGTAGGATGCTTA No data
Right 1199567635 X:149232071-149232093 GATGCTTATGACACATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199567633 Original CRISPR TAAGCATCCTACATCCTGCA TGG (reversed) Intergenic
No off target data available for this crispr