ID: 1199571804

View in Genome Browser
Species Human (GRCh38)
Location X:149273922-149273944
Sequence GAACCCTGGAGTCCAGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199571799_1199571804 -6 Left 1199571799 X:149273905-149273927 CCCTGAGTTGCCTTTAGGAACCC No data
Right 1199571804 X:149273922-149273944 GAACCCTGGAGTCCAGGTACAGG No data
1199571797_1199571804 13 Left 1199571797 X:149273886-149273908 CCTAACTGTGAGATATTTACCCT No data
Right 1199571804 X:149273922-149273944 GAACCCTGGAGTCCAGGTACAGG No data
1199571800_1199571804 -7 Left 1199571800 X:149273906-149273928 CCTGAGTTGCCTTTAGGAACCCT No data
Right 1199571804 X:149273922-149273944 GAACCCTGGAGTCCAGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199571804 Original CRISPR GAACCCTGGAGTCCAGGTAC AGG Intergenic
No off target data available for this crispr