ID: 1199574110

View in Genome Browser
Species Human (GRCh38)
Location X:149296915-149296937
Sequence CCTTCCTCTCTGGGCCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199574105_1199574110 -10 Left 1199574105 X:149296902-149296924 CCTTAAGCAAGGCCCTTCCTCTC No data
Right 1199574110 X:149296915-149296937 CCTTCCTCTCTGGGCCTCTGTGG No data
1199574103_1199574110 2 Left 1199574103 X:149296890-149296912 CCTGCAGTGTGACCTTAAGCAAG No data
Right 1199574110 X:149296915-149296937 CCTTCCTCTCTGGGCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199574110 Original CRISPR CCTTCCTCTCTGGGCCTCTG TGG Intergenic
No off target data available for this crispr