ID: 1199575133

View in Genome Browser
Species Human (GRCh38)
Location X:149306634-149306656
Sequence CTGTGTCACCAGAGGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199575124_1199575133 11 Left 1199575124 X:149306600-149306622 CCCTCTCCCCAGCAGTAAAGAGG No data
Right 1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG No data
1199575126_1199575133 10 Left 1199575126 X:149306601-149306623 CCTCTCCCCAGCAGTAAAGAGGC No data
Right 1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG No data
1199575127_1199575133 5 Left 1199575127 X:149306606-149306628 CCCCAGCAGTAAAGAGGCTGCCA No data
Right 1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG No data
1199575129_1199575133 3 Left 1199575129 X:149306608-149306630 CCAGCAGTAAAGAGGCTGCCATC No data
Right 1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG No data
1199575128_1199575133 4 Left 1199575128 X:149306607-149306629 CCCAGCAGTAAAGAGGCTGCCAT No data
Right 1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199575133 Original CRISPR CTGTGTCACCAGAGGGCACA TGG Intergenic
No off target data available for this crispr