ID: 1199576655

View in Genome Browser
Species Human (GRCh38)
Location X:149318978-149319000
Sequence TTGCTGAGCCTAATGGATAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199576655_1199576658 3 Left 1199576655 X:149318978-149319000 CCGATATCCATTAGGCTCAGCAA No data
Right 1199576658 X:149319004-149319026 ACCTGGTCTGTACTGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199576655 Original CRISPR TTGCTGAGCCTAATGGATAT CGG (reversed) Intergenic
No off target data available for this crispr