ID: 1199577884 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:149332189-149332211 |
| Sequence | GAATCGATAATTATTGAAGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199577881_1199577884 | 2 | Left | 1199577881 | X:149332164-149332186 | CCAGAGATGCAACAAAACTGGCC | No data | ||
| Right | 1199577884 | X:149332189-149332211 | GAATCGATAATTATTGAAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199577884 | Original CRISPR | GAATCGATAATTATTGAAGC TGG | Intergenic | ||