ID: 1199577884

View in Genome Browser
Species Human (GRCh38)
Location X:149332189-149332211
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199577881_1199577884 2 Left 1199577881 X:149332164-149332186 CCAGAGATGCAACAAAACTGGCC No data
Right 1199577884 X:149332189-149332211 GAATCGATAATTATTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199577884 Original CRISPR GAATCGATAATTATTGAAGC TGG Intergenic