ID: 1199578838

View in Genome Browser
Species Human (GRCh38)
Location X:149341383-149341405
Sequence CAGACACAGCTGATACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199578838_1199578846 29 Left 1199578838 X:149341383-149341405 CCTGCTTGTATCAGCTGTGTCTG No data
Right 1199578846 X:149341435-149341457 CATAGTGCCTGCACAGTGTCTGG No data
1199578838_1199578839 -8 Left 1199578838 X:149341383-149341405 CCTGCTTGTATCAGCTGTGTCTG No data
Right 1199578839 X:149341398-149341420 TGTGTCTGTGAGCAACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199578838 Original CRISPR CAGACACAGCTGATACAAGC AGG (reversed) Intergenic
No off target data available for this crispr