ID: 1199579102

View in Genome Browser
Species Human (GRCh38)
Location X:149343833-149343855
Sequence CAACCAGGAGCTCCGAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199579102_1199579107 19 Left 1199579102 X:149343833-149343855 CCTAACTTCGGAGCTCCTGGTTG No data
Right 1199579107 X:149343875-149343897 CAGATAGGAATCTACACCAATGG No data
1199579102_1199579106 4 Left 1199579102 X:149343833-149343855 CCTAACTTCGGAGCTCCTGGTTG No data
Right 1199579106 X:149343860-149343882 TCAGGCTTTCAGATTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199579102 Original CRISPR CAACCAGGAGCTCCGAAGTT AGG (reversed) Intergenic
No off target data available for this crispr