ID: 1199579316

View in Genome Browser
Species Human (GRCh38)
Location X:149345523-149345545
Sequence CCGTACACACAGAAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199579316_1199579322 22 Left 1199579316 X:149345523-149345545 CCATGCCCCTTCTGTGTGTACGG No data
Right 1199579322 X:149345568-149345590 TTTTTTGTTTTTTTTGGAGACGG 0: 7
1: 3200
2: 90796
3: 79770
4: 154857
1199579316_1199579321 16 Left 1199579316 X:149345523-149345545 CCATGCCCCTTCTGTGTGTACGG No data
Right 1199579321 X:149345562-149345584 TTTTTGTTTTTTGTTTTTTTTGG 0: 66
1: 283
2: 14429
3: 20201
4: 42759

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199579316 Original CRISPR CCGTACACACAGAAGGGGCA TGG (reversed) Intergenic
No off target data available for this crispr