ID: 1199579951

View in Genome Browser
Species Human (GRCh38)
Location X:149351125-149351147
Sequence GGCTCTGTATATTCACCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199579951_1199579960 25 Left 1199579951 X:149351125-149351147 CCCTTGGGTGAATATACAGAGCC No data
Right 1199579960 X:149351173-149351195 GATGAGCACATAATTATTTCAGG No data
1199579951_1199579961 26 Left 1199579951 X:149351125-149351147 CCCTTGGGTGAATATACAGAGCC No data
Right 1199579961 X:149351174-149351196 ATGAGCACATAATTATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199579951 Original CRISPR GGCTCTGTATATTCACCCAA GGG (reversed) Intergenic
No off target data available for this crispr