ID: 1199583261

View in Genome Browser
Species Human (GRCh38)
Location X:149382204-149382226
Sequence TGTCCTCTTCCGTGCAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199583257_1199583261 11 Left 1199583257 X:149382170-149382192 CCATGGGCAATTACTTAACTACT No data
Right 1199583261 X:149382204-149382226 TGTCCTCTTCCGTGCAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199583261 Original CRISPR TGTCCTCTTCCGTGCAAAGG GGG Intergenic
No off target data available for this crispr