ID: 1199585796 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:149414606-149414628 |
| Sequence | CCATAGGCAAGAAGAGAAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199585796_1199585801 | -4 | Left | 1199585796 | X:149414606-149414628 | CCCATTTCTCTTCTTGCCTATGG | No data | ||
| Right | 1199585801 | X:149414625-149414647 | ATGGGTTATAATGTTAAGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199585796 | Original CRISPR | CCATAGGCAAGAAGAGAAAT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||