ID: 1199585796

View in Genome Browser
Species Human (GRCh38)
Location X:149414606-149414628
Sequence CCATAGGCAAGAAGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199585796_1199585801 -4 Left 1199585796 X:149414606-149414628 CCCATTTCTCTTCTTGCCTATGG No data
Right 1199585801 X:149414625-149414647 ATGGGTTATAATGTTAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199585796 Original CRISPR CCATAGGCAAGAAGAGAAAT GGG (reversed) Intergenic
No off target data available for this crispr