ID: 1199587751

View in Genome Browser
Species Human (GRCh38)
Location X:149434159-149434181
Sequence ACTGCTTGGAAAAGACCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199587751_1199587754 -5 Left 1199587751 X:149434159-149434181 CCTTTAGGTCTTTTCCAAGCAGT No data
Right 1199587754 X:149434177-149434199 GCAGTGGAAAACTGCCTAGATGG No data
1199587751_1199587756 17 Left 1199587751 X:149434159-149434181 CCTTTAGGTCTTTTCCAAGCAGT No data
Right 1199587756 X:149434199-149434221 GACACACCAAACCACCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199587751 Original CRISPR ACTGCTTGGAAAAGACCTAA AGG (reversed) Intergenic
No off target data available for this crispr