ID: 1199587753

View in Genome Browser
Species Human (GRCh38)
Location X:149434173-149434195
Sequence CTAGGCAGTTTTCCACTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199587753_1199587756 3 Left 1199587753 X:149434173-149434195 CCAAGCAGTGGAAAACTGCCTAG No data
Right 1199587756 X:149434199-149434221 GACACACCAAACCACCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199587753 Original CRISPR CTAGGCAGTTTTCCACTGCT TGG (reversed) Intergenic
No off target data available for this crispr