ID: 1199587756

View in Genome Browser
Species Human (GRCh38)
Location X:149434199-149434221
Sequence GACACACCAAACCACCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199587751_1199587756 17 Left 1199587751 X:149434159-149434181 CCTTTAGGTCTTTTCCAAGCAGT No data
Right 1199587756 X:149434199-149434221 GACACACCAAACCACCCTGATGG No data
1199587753_1199587756 3 Left 1199587753 X:149434173-149434195 CCAAGCAGTGGAAAACTGCCTAG No data
Right 1199587756 X:149434199-149434221 GACACACCAAACCACCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199587756 Original CRISPR GACACACCAAACCACCCTGA TGG Intergenic
No off target data available for this crispr