ID: 1199593512

View in Genome Browser
Species Human (GRCh38)
Location X:149489028-149489050
Sequence CTCCCAGGCGGTTCTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 190}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199593503_1199593512 30 Left 1199593503 X:149488975-149488997 CCCAGAACTGCGAGCTCCTGAGA 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG 0: 1
1: 0
2: 1
3: 20
4: 190
1199593508_1199593512 -6 Left 1199593508 X:149489011-149489033 CCAGCATGTTTTACTGGCTCCCA 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG 0: 1
1: 0
2: 1
3: 20
4: 190
1199593505_1199593512 14 Left 1199593505 X:149488991-149489013 CCTGAGACCAGTTGCAGAAACCA 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG 0: 1
1: 0
2: 1
3: 20
4: 190
1199593506_1199593512 7 Left 1199593506 X:149488998-149489020 CCAGTTGCAGAAACCAGCATGTT 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG 0: 1
1: 0
2: 1
3: 20
4: 190
1199593504_1199593512 29 Left 1199593504 X:149488976-149488998 CCAGAACTGCGAGCTCCTGAGAC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG 0: 1
1: 0
2: 1
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199593512 Original CRISPR CTCCCAGGCGGTTCTGATGG AGG Intronic
900131975 1:1091111-1091133 CTCCCAGGCGGAGCGGGTGGAGG - Intronic
900318032 1:2069155-2069177 CTCCCGGGCGGGGCTGACGGAGG - Intronic
900655366 1:3754250-3754272 TTCACAGGCGGTCCTGGTGGGGG - Intronic
903070766 1:20726089-20726111 CTGCCCGGTGGGTCTGATGGGGG - Intronic
907340040 1:53728414-53728436 CTCCAAGGCTGTTGTGAGGGTGG - Intronic
916037747 1:160936011-160936033 CTCCCTGGAGCTTCTGGTGGTGG + Intergenic
920852570 1:209638426-209638448 TTCCCAGGCATTTCTTATGGTGG - Intronic
923029571 1:230236840-230236862 CTCCCAAGCGGCTCTGGTAGAGG - Intronic
924170333 1:241332846-241332868 CTCCTAGGTGGTTCTGAAGGTGG - Intronic
924638969 1:245815443-245815465 CTCCCCAGCTATTCTGATGGAGG - Intronic
1069685891 10:70318258-70318280 CTCCCAAGAGTTTCTGATGTAGG + Intronic
1070380490 10:75876643-75876665 CTCCCAGGGGCTTCTGGTGCAGG + Intronic
1071406054 10:85333752-85333774 CTCCCAGGCTGTGCAGCTGGTGG + Intergenic
1072337633 10:94412987-94413009 CCCCCAGGTGATTCTGATGCAGG + Intronic
1072479136 10:95793674-95793696 CTTCCAGGTGATTCTGATGCAGG + Intronic
1072843075 10:98796391-98796413 CTCCCATGGGCTGCTGATGGTGG + Intronic
1073240692 10:102055986-102056008 CCCCGAGGCGGTTCTGGGGGCGG - Intronic
1074758572 10:116646830-116646852 TGCCCAGGCAGTTCTGCTGGGGG - Intergenic
1074761954 10:116673615-116673637 CACCCAGGCAATTCTGATGCAGG + Exonic
1074940931 10:118235568-118235590 CTCCCAGGGAGTTTTAATGGTGG + Intergenic
1074979854 10:118610732-118610754 CTCCCTGGCTGGTCTCATGGGGG - Intergenic
1076902865 10:133348255-133348277 CCCCCAGCTGGTTCTGATGCTGG - Intronic
1077395335 11:2317668-2317690 CTCCCAGCCCGTTCCCATGGAGG - Intronic
1078736532 11:14025593-14025615 CTTCCAGGTGGTTCTTATAGGGG + Intronic
1080466269 11:32500227-32500249 GTCCCAGGCTGCTCAGATGGAGG + Intergenic
1081749446 11:45499435-45499457 TTCCCATGCCTTTCTGATGGTGG + Intergenic
1082089949 11:48081100-48081122 CGCCCAGGTGTTTCTGATGCGGG + Intronic
1084949773 11:72658231-72658253 CTCCCAGCCCAATCTGATGGGGG - Intronic
1086099252 11:83082047-83082069 ATCCCAGGAGATTCTGATGTTGG - Intergenic
1087768576 11:102182153-102182175 TTCCCAGGTGGTGCTGATGCCGG - Intronic
1091677651 12:2502981-2503003 CTCCCAGATGTTTCTGATGCTGG + Intronic
1091847421 12:3668342-3668364 ATCCCAGGCGGTTCTGATACAGG - Intronic
1092558921 12:9588871-9588893 ATCCCAGGCTGTTCACATGGTGG - Intergenic
1094285803 12:28792173-28792195 GTCCTAGGAGGTTCTGATGGTGG - Intergenic
1096588451 12:52641455-52641477 CTCCTAGGTGATTCTGATGCTGG - Intergenic
1099603115 12:84766887-84766909 CTCCCAGCAGGTTCCGAGGGGGG - Intergenic
1103863640 12:124034159-124034181 CCTCCAGGTGGTTCTGATGTAGG - Intronic
1104466336 12:128993870-128993892 CTCCCAGGAGGATCTGCTGGGGG - Intergenic
1104656912 12:130580332-130580354 CCCCCATGCTGTTCTCATGGTGG + Intronic
1106311841 13:28561475-28561497 GTCCCATGCTGTTCTCATGGTGG + Intergenic
1106828743 13:33555016-33555038 CTCCCAGGTGGTTCTGAGGCTGG + Intergenic
1110246154 13:73326891-73326913 ATCCCAGGAGATTCTGATGAAGG + Intergenic
1112487052 13:99829308-99829330 TGCCAAGGCGGTTCTGATGCAGG + Intronic
1113414463 13:110117558-110117580 CTCTCAGGAGGTTCAGAAGGCGG + Intergenic
1114593903 14:23894717-23894739 CTCTCAGGTGGTTCTGAGGCAGG + Intergenic
1115332485 14:32213084-32213106 CACCCAGGGGATTCTGATGCAGG + Intergenic
1115730640 14:36265693-36265715 CCCCCAGGCTGTTCTCATGATGG - Intergenic
1117035590 14:51725049-51725071 CTCCCAGGGGGATCTGCTGCAGG + Intronic
1118511635 14:66481041-66481063 ATCCCTGGTGGTTCTGATGCGGG - Intergenic
1119226725 14:72950127-72950149 GTCCCAGGGGGTTGTGATTGTGG + Intronic
1121183053 14:91943826-91943848 CTGCCAGCAGGTCCTGATGGAGG + Intronic
1123781712 15:23634584-23634606 CTACCAGGCGGTACTGAGGTGGG + Intergenic
1129437738 15:75555827-75555849 CTCCCAAGGGATGCTGATGGTGG + Intronic
1131517650 15:93089420-93089442 CACCCAGCCGGTGCTGATGCGGG - Intergenic
1132600513 16:770702-770724 CCCCCAGGCGGCTCCCATGGTGG - Intronic
1133037769 16:3044024-3044046 CTCCCAGGCAGCTCTGAAAGTGG - Intergenic
1133732679 16:8590138-8590160 CTTCCAGGAGGGTCTGAAGGCGG - Intergenic
1135329792 16:21551462-21551484 CTCCCCAGGGGTTCTGATGTGGG + Intergenic
1135483916 16:22846825-22846847 CTGCAAGGTGGTTATGATGGTGG + Intronic
1136340132 16:29637432-29637454 CTCCCCAGGGGTTCTGATGTGGG + Intergenic
1139471317 16:67179511-67179533 GTCCCAGGCAGTGATGATGGTGG - Exonic
1141484384 16:84329171-84329193 CTTCCTGGTGTTTCTGATGGTGG + Intronic
1141848711 16:86629508-86629530 CTCTCAGGCAGTTCTGATGGTGG + Intergenic
1142408763 16:89905601-89905623 CTCCCAGGCGGTCCTGAGCCTGG - Intronic
1142757618 17:2025167-2025189 TTCGCAGGCGGTTTTGAGGGGGG + Exonic
1142767621 17:2074425-2074447 CTCCCAGGGGATGCTGCTGGTGG - Intronic
1143547456 17:7606367-7606389 TTTCCAGGCTGTTCTGATGCAGG - Intronic
1145766364 17:27460743-27460765 CTCCCAGGAGCATCTGATGATGG + Intronic
1147747917 17:42706968-42706990 TGCCCAGGCGGTTTTGCTGGAGG - Intronic
1147782721 17:42955259-42955281 TTCCCAGTCGTTTCTGATGTTGG + Intronic
1148002830 17:44399864-44399886 CTCCCAGGGGGTTCTGGTTTGGG + Exonic
1149540347 17:57463598-57463620 CACCCCGGAGATTCTGATGGAGG - Intronic
1152399069 17:80053347-80053369 CTCCAAGGCGCAGCTGATGGAGG - Intronic
1152562075 17:81083599-81083621 GTCCCATGTGGTGCTGATGGGGG + Intronic
1152613814 17:81328888-81328910 CCCCCAAGGGGCTCTGATGGGGG + Intronic
1154027934 18:10725357-10725379 GTCCCAGGCGGTGATGATGGTGG + Intronic
1155970099 18:32075034-32075056 ATCCCAAGTGGTTCTGATGGCGG - Intergenic
1157326586 18:46673581-46673603 CACCCAGGTGATTCTGATGCAGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1158570835 18:58595875-58595897 CTCCCAGGGGATGCTGATGCTGG + Intronic
1158984898 18:62804221-62804243 CTCCCATGCTGTTCTCATGATGG - Intronic
1161619397 19:5290412-5290434 CTCCCCCGCGGTGCTAATGGGGG + Intronic
1161672926 19:5624076-5624098 CTCCCGGGCAGTTCTGAGGCTGG - Intronic
1161983294 19:7641614-7641636 CTCCCAGGAGGTGCAGGTGGCGG + Intronic
1164394268 19:27850274-27850296 CTCCAAGGCGGTGGAGATGGGGG - Intergenic
924966191 2:78473-78495 TTCCCAGGCTGTTCTCATGATGG - Intergenic
926022103 2:9505466-9505488 CTCCAGGGTGGCTCTGATGGTGG - Intronic
927364122 2:22274360-22274382 CTTCCAGGTGATTCTGATGCAGG - Intergenic
927399875 2:22698506-22698528 CCCCCAGGCAGCTCTGATGCAGG + Intergenic
929773789 2:44915118-44915140 CCTCCAGGTGGTTCTGATGGAGG + Intergenic
929861745 2:45684172-45684194 CTCCCAGGAGCTTCTGAAGTTGG + Intronic
930642026 2:53863013-53863035 CTCCCAGGTGATTCTGATTCTGG - Intergenic
930732941 2:54745414-54745436 CTGCCAGGAGATACTGATGGAGG + Intronic
931243331 2:60471799-60471821 CTCCCAGGTGATGCTGATCGGGG - Intronic
931345300 2:61440303-61440325 CTCCCTGGTGGTCCTGCTGGAGG + Intronic
932053964 2:68425954-68425976 CTCCCAGGGGATGCTGCTGGTGG - Intergenic
935423235 2:102892765-102892787 CTCCCCGGCTGTCCTGAGGGAGG + Intergenic
937060836 2:118979397-118979419 CTCCTAGGCTGGTCTGATGAGGG + Intronic
937212965 2:120289357-120289379 ATCCCAGGGGATTCTGATGTGGG + Intronic
941349341 2:164413472-164413494 CTCCCATGCTGTTCTCATGATGG - Intergenic
942427326 2:175873829-175873851 CTCCCAGGTGATGCTGATGTTGG - Intergenic
947544441 2:231001101-231001123 CCCCCAGGCTGGTCTGTTGGTGG + Intronic
948407904 2:237736675-237736697 CTCCCAGGCAATTCTTGTGGGGG - Intronic
948652358 2:239456270-239456292 CTCCCAGGCTGTTCTGCTCCAGG + Intergenic
1169652466 20:7884862-7884884 CTCCCAGTCTGTTCTGATCATGG - Intronic
1173022962 20:39283335-39283357 ATCCCAGGTGATTCTGATGCAGG + Intergenic
1174093298 20:48067137-48067159 CACCCAGGGGGCTCTGAAGGTGG - Intergenic
1174262472 20:49306691-49306713 CTCCCAGGGGATGCTGATGCTGG + Intergenic
1174511687 20:51058136-51058158 CTCCCAGGCGGCTCTCATTTGGG - Intergenic
1175583794 20:60121415-60121437 CTCCCAGGGGCTACTGGTGGGGG + Intergenic
1175664238 20:60844479-60844501 CTCCAAGGCGGTGGTGATGGTGG + Intergenic
1175912345 20:62410887-62410909 CTCCCAGGGGCTGCTGTTGGGGG + Exonic
1176047228 20:63099251-63099273 CTTCCAGGTGGGTCTGAGGGAGG - Intergenic
1176194867 20:63832154-63832176 GTCCCAGGCCGTTCGGATCGGGG - Intergenic
1178621787 21:34183573-34183595 CTTCCAGGCGACTCTGATGCTGG + Intergenic
1179105719 21:38398560-38398582 CTCCCATGCCGCTCTGATGGTGG - Intronic
1179712459 21:43271269-43271291 CTCCTAGGTGGTCCTGGTGGAGG - Intergenic
1179887014 21:44318611-44318633 GGGCCAGGCGGTTCTGATGGGGG - Intronic
1181574081 22:23782997-23783019 CTCCCAGTGGGTCCTGATGTGGG - Intronic
1182961818 22:34482469-34482491 CTCTCAGTTGGTTCTGATTGTGG + Intergenic
1183543247 22:38441811-38441833 CTTCCAGGCGGTGCTGCTGAAGG - Intronic
1184037930 22:41927257-41927279 CACCCAGGCGGTGCTGGTTGAGG - Intergenic
1184189310 22:42884420-42884442 CTTCCGGGAGGTTCTGCTGGAGG - Exonic
1185190564 22:49433498-49433520 CTCCCCGGCATTTCTCATGGTGG - Intronic
949620078 3:5800939-5800961 CTCCCAGGCCCTTCTGAAGAAGG - Intergenic
950956911 3:17063520-17063542 CTCCCTGGAGGTTCTGATTTAGG - Intronic
951452390 3:22853880-22853902 CTCCCATACTGTTCTCATGGAGG - Intergenic
951591072 3:24265248-24265270 CTCCCAGGCCTTTCTGATCCTGG + Intronic
952277454 3:31891236-31891258 CTTCCAGGTGATTCTGATGTGGG - Intronic
954482094 3:50809450-50809472 CTCCCAGACATTACTGATGGTGG + Intronic
956711110 3:72039611-72039633 ATCCCAGGGGCTTCTGATGTGGG + Intergenic
961135326 3:124504769-124504791 CTCCCAGGCAGCTCTGAAGCAGG - Intronic
961486398 3:127220256-127220278 TTCCCAGGCGATGCTGATGCTGG + Intergenic
964408251 3:156372415-156372437 CTTCCAGGTGATTCTGATGCAGG - Intronic
965757202 3:172039594-172039616 CTACCAGGAGGGTTTGATGGGGG - Intergenic
966207804 3:177422725-177422747 ATCCCAGGTTATTCTGATGGGGG + Intergenic
966711737 3:182979934-182979956 CTCCCAGGCAGTTTTGCTTGGGG - Intronic
968428150 4:536473-536495 CTCCCAAGCTGGTCTGTTGGTGG - Intronic
968554450 4:1240163-1240185 CCCCCACGCGGTTCTGACGAGGG - Intronic
968554487 4:1240272-1240294 CCCCCAGGCGGTTCCGACGAGGG - Intronic
969350444 4:6595186-6595208 CTCTCAGGCTGTGCTGCTGGTGG - Intronic
969622889 4:8287614-8287636 CCCCCATGCTGTTCTCATGGTGG - Intronic
972997870 4:44904954-44904976 CCCCCATGCTGTTCTGATAGTGG + Intergenic
975498040 4:75055993-75056015 CTCCCAGGTGGTGCTAATGCTGG + Intergenic
976225072 4:82789509-82789531 CTCCCAGGTGATGCTGATGCTGG + Intronic
979690448 4:123553552-123553574 ACCCCAGGTGGTTCTGATGCGGG - Intergenic
980069163 4:128224630-128224652 CTCCCAGGAGTTTCTAAAGGTGG - Intergenic
980522043 4:133948005-133948027 CTCCCAGGCCATTCAGCTGGTGG + Intergenic
980758976 4:137203095-137203117 CCCCCATGCTGTTGTGATGGTGG - Intergenic
981045443 4:140260774-140260796 ATCCCAGGTGATTCTGATGCAGG + Intronic
981583085 4:146270611-146270633 CTCCCAGGTGATTCTAATGTGGG + Intronic
984635483 4:182105311-182105333 CTCCCAGGAAGTTCTGAGGCCGG + Intergenic
986262544 5:6160965-6160987 CTCTCAGACAGTTCTGCTGGGGG - Intergenic
989134289 5:38137334-38137356 CACCCAGGTGATTCTGATGCAGG + Intergenic
990514865 5:56521659-56521681 CTCCTAGGAGGTTCATATGGCGG - Intronic
996636006 5:125691019-125691041 TTCCCATGCTGTTCTCATGGTGG + Intergenic
996885660 5:128350893-128350915 CCCCCAGGCGGCTCCGAGGGTGG + Exonic
997627166 5:135338987-135339009 CTCCCAGGTGGGGCTGATGGTGG - Intronic
998216372 5:140241072-140241094 CTCCCAGGCAGTGCTGACAGAGG - Intronic
1000966450 5:167662798-167662820 CTCTCAGGTGATGCTGATGGTGG - Intronic
1003279041 6:4676161-4676183 TTCCCAGGGGATTCTGATGGAGG + Intergenic
1006368839 6:33632307-33632329 CTCCCATGGTGCTCTGATGGTGG + Intronic
1012163902 6:95924128-95924150 CTCCCAGGCAGCTGTGATGGTGG - Intergenic
1013454476 6:110317789-110317811 CTCCCAGGTGATTCTGATGTAGG - Intronic
1016304672 6:142671210-142671232 CTCCCATGCTGTTCTAGTGGTGG + Intergenic
1016987366 6:149905434-149905456 CTCCTAGGCTGCCCTGATGGAGG + Intergenic
1017672057 6:156777989-156778011 CTCCGAGGCGGCTCTCAAGGAGG + Exonic
1019073715 6:169370249-169370271 GTCCCAGGAGGTGCTGATGGAGG + Intergenic
1019129165 6:169860742-169860764 CCCCCAGGCTGTTCTCATGATGG + Intergenic
1019543745 7:1562972-1562994 CTGCCAGGCGGCTGTGAAGGAGG + Intergenic
1019554079 7:1619932-1619954 CTCCGAGGCGGTTCGGATGAGGG - Intergenic
1019607499 7:1917473-1917495 CGGCCAGGCGGTGCTGAGGGCGG - Intronic
1022612870 7:31894819-31894841 CTCCCTGGGGGTTCTCGTGGTGG - Intronic
1022704351 7:32788550-32788572 CTCCCTGGTGATTCTGATGCAGG - Intergenic
1025079711 7:55970876-55970898 CTCCCAGGCCAAGCTGATGGTGG + Intronic
1026004651 7:66591617-66591639 CTCCCAGACGGTTCGGAAGCAGG + Intergenic
1026013637 7:66655243-66655265 CTCCCAGACGGTTCGGAAGTAGG - Intronic
1026025638 7:66741404-66741426 CTCCCAGACGGTTCGGAAGCAGG - Intronic
1026031125 7:66795236-66795258 CTCGCAGGCGGTTTGAATGGTGG - Intronic
1026497825 7:70919011-70919033 CTCCCATGCTGTTCTGATAGTGG + Intergenic
1029616942 7:101665042-101665064 CTCCCAGGCTGTGTTGCTGGGGG - Intergenic
1032335786 7:131023205-131023227 CCCCCAGGCTGTTCTCATGATGG + Intergenic
1032486137 7:132288889-132288911 CTCCCAGGATGTTCTGAGGAAGG - Intronic
1034270082 7:149799524-149799546 CTCCCTGTGAGTTCTGATGGAGG - Intergenic
1034928936 7:155145019-155145041 CCCTCATGCGGTTCTGATGCTGG - Intergenic
1035556801 8:573125-573147 CCCCCAGGCGGTTCTGACACCGG + Intergenic
1035744775 8:1953919-1953941 CTCCCAGGCCGACCTGACGGTGG + Intronic
1036499384 8:9299249-9299271 ACCCCAGGAGGTTCTGATGCAGG + Intergenic
1037565653 8:20116137-20116159 CTCCCATACTGTTCTCATGGTGG - Intergenic
1041290929 8:56307799-56307821 CACCCCGGTGGTTCTGATGCAGG + Intronic
1047965306 8:130042070-130042092 CCCCCAGGTGATTCTGATGTCGG - Intergenic
1048274630 8:133056986-133057008 TTCCCAGGGGATTCTGATGCAGG + Intronic
1053311831 9:37025405-37025427 ATCCCAGGCTGTTGGGATGGGGG + Intronic
1055035384 9:71812737-71812759 CTCCCAGCCTGTTTTGAGGGTGG + Intronic
1056888743 9:90469587-90469609 CTCCCAGGCCGTTCTTAATGAGG + Intergenic
1057857101 9:98610110-98610132 CTCCTAGGCGGGGCGGATGGAGG - Intronic
1058703151 9:107617362-107617384 CTCCCAGGTGATTCTGCTGGTGG + Intergenic
1060640269 9:125232363-125232385 ATCTCAGGCGATTCTGATGTAGG - Intronic
1060791876 9:126490536-126490558 CTCCGCCGCGGTTTTGATGGTGG - Intronic
1061012800 9:127965395-127965417 CTCCCAGGTGATTCTGATGCAGG + Intronic
1061313050 9:129776725-129776747 CTCCCAGAGGGTTCTGAGGTTGG + Intergenic
1061837947 9:133341700-133341722 CTCCCTGGGGTTTCTGGTGGTGG - Intronic
1062253436 9:135609460-135609482 CTCCCAGGTGGCTCACATGGGGG + Intergenic
1186881420 X:13870443-13870465 TCCCCAGGAGGTTCTGATAGTGG + Intronic
1189097173 X:38152560-38152582 CCTCCAGGGGATTCTGATGGAGG + Intronic
1189611150 X:42737443-42737465 CTTCCATGTGATTCTGATGGAGG - Intergenic
1189867517 X:45346520-45346542 CCCCCAGGTGCTTCTGATGCAGG - Intergenic
1192190924 X:68990769-68990791 CTCCCAGGCAGGGCTGCTGGAGG - Intergenic
1192797552 X:74436806-74436828 CTTCTAGGCTGTTCTGATGTTGG + Intronic
1193863442 X:86699522-86699544 CTCCCATACTGTTCTCATGGTGG - Intronic
1199593512 X:149489028-149489050 CTCCCAGGCGGTTCTGATGGAGG + Intronic
1201284639 Y:12368721-12368743 CGCCCAGGGGTTTCTGTTGGGGG + Intergenic