ID: 1199598624

View in Genome Browser
Species Human (GRCh38)
Location X:149527043-149527065
Sequence CAGTGTGGCGGGAATCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199598624_1199598630 10 Left 1199598624 X:149527043-149527065 CCTTTTAGATTCCCGCCACACTG 0: 2
1: 0
2: 1
3: 9
4: 95
Right 1199598630 X:149527076-149527098 GGACAATGTGACCTCTAAGCTGG 0: 2
1: 0
2: 0
3: 7
4: 122
1199598624_1199598631 13 Left 1199598624 X:149527043-149527065 CCTTTTAGATTCCCGCCACACTG 0: 2
1: 0
2: 1
3: 9
4: 95
Right 1199598631 X:149527079-149527101 CAATGTGACCTCTAAGCTGGTGG 0: 2
1: 0
2: 0
3: 4
4: 97
1199598624_1199598632 19 Left 1199598624 X:149527043-149527065 CCTTTTAGATTCCCGCCACACTG 0: 2
1: 0
2: 1
3: 9
4: 95
Right 1199598632 X:149527085-149527107 GACCTCTAAGCTGGTGGCCTAGG 0: 2
1: 0
2: 0
3: 4
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199598624 Original CRISPR CAGTGTGGCGGGAATCTAAA AGG (reversed) Intronic
910796275 1:91100599-91100621 CAGTCTTGTGGGAATCAAAAGGG - Intergenic
922851943 1:228739953-228739975 CAGTGTGGAGGGAAGACAAATGG + Intronic
1063707048 10:8440747-8440769 AAGGGTGGTGGGAAGCTAAAGGG - Intergenic
1065828009 10:29589351-29589373 CAGTGTGGTGGGAATCTGGAGGG + Intronic
1065949750 10:30641257-30641279 CAGTGTGACGGGAATCTGGAGGG - Intergenic
1071146554 10:82581048-82581070 CATTGTGGTGGGAATGTAAATGG - Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076242871 10:128923074-128923096 CAGTGGGGCGGGGACCCAAATGG + Intergenic
1082888078 11:58109407-58109429 CAGTGTGGCCAGAATCTGAGGGG + Intronic
1084770034 11:71336676-71336698 CCGTGGGGTGGGAAACTAAAGGG - Intergenic
1091098384 11:132845708-132845730 CAGAGTGACGGGAATCTCTATGG - Intronic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1091598455 12:1898657-1898679 CAGAGTTGTGGGAATGTAAAAGG - Intronic
1091810106 12:3389873-3389895 GAGTTTGGGGGGATTCTAAAGGG + Intronic
1095686652 12:45043464-45043486 CAGAGTGGCTGGATTCTGAAAGG - Intronic
1098250929 12:68568960-68568982 AAGTGGGGCGGTAATCTAGAAGG - Intergenic
1102099399 12:110266842-110266864 CAGTGGGGAGGGAAGGTAAAGGG - Intergenic
1107030919 13:35853026-35853048 CAGTGAGGCGTCAATCTATAGGG - Intronic
1112613447 13:100978727-100978749 CAGTGTTGTGGGAATGTACAAGG + Intergenic
1113419490 13:110159493-110159515 CGCTGTGGCAGGAATGTAAAGGG + Intronic
1114731641 14:24999581-24999603 CAATGTTACGGGAATCCAAAGGG + Intronic
1114947791 14:27707889-27707911 AAGTTTGTGGGGAATCTAAAGGG + Intergenic
1117108884 14:52428017-52428039 CAATGTGGCTGGAGTCTAATGGG - Intergenic
1119036455 14:71233740-71233762 CAGTGTTGTGAGACTCTAAATGG + Intergenic
1127861452 15:62997508-62997530 AAGTGTGGCTGGAATGCAAAGGG + Intergenic
1129205691 15:74035871-74035893 CAGGGTGGTGGGAATGTAATTGG - Intronic
1129518262 15:76170234-76170256 CCGTGTGGCGGGAAGCAGAACGG - Intronic
1129591813 15:76921850-76921872 CAGTGTTGCTCTAATCTAAAGGG - Intergenic
1129633426 15:77288540-77288562 CAGTGAGAAGGGAAACTAAATGG + Intronic
1132514969 16:361973-361995 CAGTCTGGTGGGAAAATAAAGGG + Intergenic
1136414448 16:30095213-30095235 CAGTGGGGCTGGAACCTATAGGG - Intronic
1140237958 16:73175464-73175486 TAGTGTGGCTGGAACATAAAAGG - Intergenic
1141636994 16:85319304-85319326 CAGTGTAGCGGGAGTCCTAATGG + Intergenic
1145015037 17:19391050-19391072 CAGTGTGTGGGGACTCTACAAGG - Intergenic
1146726206 17:35158377-35158399 CATGGTGGCTGGATTCTAAATGG + Intronic
1150257152 17:63756640-63756662 CAGCGGGGAGGGAATCTTAAGGG - Intronic
1156219412 18:35036614-35036636 CAGTGTAGAGGGAAGATAAAGGG - Intronic
1156794222 18:41022503-41022525 CAGTGGGAAGGGAATCAAAACGG - Intergenic
1157081980 18:44535255-44535277 CAGTGTGGCAGCAATGTAAAGGG + Intergenic
1158099792 18:53818266-53818288 CAGTGAGGCAGAAATCAAAAGGG + Intergenic
1158443606 18:57499626-57499648 AAGTGTTGCTGGCATCTAAAGGG + Intergenic
1159310633 18:66703051-66703073 CAGTGGGGCGGGAGTCAAATAGG - Intergenic
1164481293 19:28612868-28612890 GAGTGTACCGGGACTCTAAAAGG + Intergenic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
926129593 2:10293713-10293735 TAGAGTGGCTGGAATCCAAAAGG - Intergenic
926599731 2:14829593-14829615 CAGTGTGGTGGGAAGGTAATAGG - Intergenic
929827394 2:45319807-45319829 CAGGGTGGCTGGAACCTACAGGG - Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931680678 2:64746692-64746714 TAGTGTGGCAGGAATCATAAAGG - Intronic
935492039 2:103733505-103733527 CAGTGTGGCGGGGATGTAGGTGG + Intergenic
938938707 2:136149718-136149740 GAGGGTGGGGGGAATCTAGAAGG + Intergenic
944189212 2:196983367-196983389 CAGTGTGGCTGGAGACTCAAGGG - Intronic
945297327 2:208183559-208183581 CAGTGTGGTGGGAATTTGGAGGG + Intronic
946026256 2:216673536-216673558 GAGTGAGGCACGAATCTAAAGGG + Exonic
1169975141 20:11316801-11316823 CAGTGTGACAGGAATAGAAAGGG + Intergenic
1180239503 21:46491129-46491151 CAGAGTGGCAGAAATCTAATTGG - Intronic
1181861421 22:25822135-25822157 CAGTGTGGCTGGAATGTAACGGG - Intronic
1183789225 22:40051534-40051556 CAGTGTGGGGGCAATCTGTAGGG - Intronic
958537341 3:95420667-95420689 CAGTGTGGCGGGGCTCTGACTGG + Intergenic
959931260 3:111985706-111985728 AAGTGTGGGAGCAATCTAAATGG + Intronic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
965708166 3:171530521-171530543 CAGTGAGGCAGGAAACGAAAGGG + Intergenic
967133236 3:186491879-186491901 CAGGGTGGTGGGATTTTAAATGG + Intergenic
971885408 4:32439710-32439732 CACTGTTCCGGAAATCTAAAAGG - Intergenic
973168075 4:47102669-47102691 CAATGTGGCTGGAACATAAAGGG + Intronic
987879266 5:23720532-23720554 CAGTGTAGGGGGAATCCAGAGGG - Intergenic
988446963 5:31297656-31297678 CAGTTTGGGGTGAAGCTAAAAGG + Intronic
996196897 5:120619199-120619221 AAGTGCAGCGGCAATCTAAAGGG - Intronic
999332546 5:150686060-150686082 CATTGTGGTAGGAATGTAAAGGG + Intergenic
1000404208 5:160869513-160869535 AAGTGCAGGGGGAATCTAAAGGG - Intergenic
1001392450 5:171390323-171390345 CAGTGTGACTGGAATTTACATGG - Intronic
1002513008 5:179735245-179735267 CAGGGTGGCAGGATTCTGAAAGG - Intronic
1007097545 6:39223104-39223126 AGGTGTGGTGGGAATCTAATTGG - Intronic
1013303669 6:108828256-108828278 CAGGGTGGCTAAAATCTAAAAGG + Intergenic
1013673808 6:112434809-112434831 CAGTGTGGTGGTAATGGAAATGG - Intergenic
1013938417 6:115629197-115629219 TAGTGTGGCAGGAGTCTAACTGG - Intergenic
1015038495 6:128687358-128687380 CAGTCTGTCTGGAATTTAAAGGG + Intergenic
1015905952 6:138116594-138116616 CAGTGTGGCAGCATTCCAAAAGG + Intergenic
1017589425 6:155962413-155962435 CATGGTGGCTGGAATCCAAAAGG + Intergenic
1020657172 7:10941256-10941278 TAGTGTGGCTGGAAAGTAAAAGG + Intergenic
1021665932 7:22979973-22979995 CAGTGTTGTGGGAATTTAATGGG - Intronic
1025241996 7:57284494-57284516 CAATGTGGCGGCAATCAAACTGG - Intergenic
1028362161 7:89981725-89981747 CAGTGTGGTGGAAATCTGAAGGG - Intergenic
1032765749 7:134991342-134991364 CAGTGTGGAGGGAATCTGAAGGG - Intronic
1035976488 8:4317743-4317765 CAGTGTGGAAGTAACCTAAATGG - Intronic
1038661633 8:29502517-29502539 CCATGGGCCGGGAATCTAAAAGG - Intergenic
1043797437 8:84561965-84561987 CTGTTTGGTGGAAATCTAAAAGG - Intronic
1044549736 8:93498440-93498462 GTGGGGGGCGGGAATCTAAATGG - Intergenic
1045678477 8:104633333-104633355 CAGTGTGGCGGCAGGCTGAAGGG + Intronic
1046194868 8:110848772-110848794 CGGTGTGGCTGGAAGCTACATGG + Intergenic
1046970977 8:120223112-120223134 CAGTGTGGCTGGAACCCAAAAGG + Intronic
1047285352 8:123483165-123483187 CAGTGTTGCTGGAATCAAAGTGG + Intergenic
1047706178 8:127502004-127502026 AAGTGAAGCTGGAATCTAAAGGG + Intergenic
1048432330 8:134381959-134381981 CAGAGTGGTGGGATTCTACAGGG - Intergenic
1049274257 8:141711785-141711807 GAGTGTGCCGAGAATCCAAATGG + Intergenic
1051599801 9:18861617-18861639 CAGTGTGATGGGCATCTGAAGGG - Intronic
1052199260 9:25757864-25757886 GAGTGTGGCAGTTATCTAAAAGG - Intergenic
1057458249 9:95234392-95234414 CAGTTTGGTGAGAATCTCAATGG - Intronic
1059155347 9:111984216-111984238 CAATGTGGCAGGAATGTACAAGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1203565528 Un_KI270744v1:84662-84684 CAGGGTGGAGGGAGGCTAAAGGG - Intergenic
1187911710 X:24117571-24117593 CAGTGTGGAGGGAATCACAGAGG - Intergenic
1192560998 X:72127963-72127985 CTGTGTGGTGGGACTCTGAATGG + Exonic
1199012495 X:142774231-142774253 CATTGTGGCAGCATTCTAAAAGG + Intergenic
1199082660 X:143593906-143593928 CAGTGTGGCTAGAATATAAATGG - Intergenic
1199593395 X:149488388-149488410 CAGTGTGGCGGGAATCTAAAAGG + Intronic
1199598624 X:149527043-149527065 CAGTGTGGCGGGAATCTAAAAGG - Intronic