ID: 1199598696

View in Genome Browser
Species Human (GRCh38)
Location X:149527377-149527399
Sequence TTATTGATGAGTGGGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199598690_1199598696 21 Left 1199598690 X:149527333-149527355 CCAGAATCATTGGGCATCTCTGA 0: 2
1: 0
2: 0
3: 12
4: 141
Right 1199598696 X:149527377-149527399 TTATTGATGAGTGGGTAAGAGGG 0: 2
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199598696 Original CRISPR TTATTGATGAGTGGGTAAGA GGG Intronic
900276486 1:1832721-1832743 TTATTGGTGACTGTGTAATATGG - Intronic
900583306 1:3419924-3419946 TTTTTGAAGGGTGGGTAAGGGGG - Intronic
904936846 1:34136995-34137017 TGATTGATGAGTGGGTAAAGTGG - Intronic
907688880 1:56642828-56642850 TGAATGGTAAGTGGGTAAGAAGG - Intronic
908598454 1:65712384-65712406 TCATTGAGGAGTGGGAAAGCAGG + Intergenic
909275114 1:73673901-73673923 TAATTGCTGTGAGGGTAAGAAGG - Intergenic
909583921 1:77267946-77267968 TCATAGATGAGTGGGGAAGAGGG + Intergenic
909750358 1:79152223-79152245 TGATTGATGATTGGGTCAGTGGG - Intergenic
910192177 1:84605606-84605628 TCATTCCTGAGAGGGTAAGAAGG - Intergenic
910560501 1:88584848-88584870 TTATTGATAAGAAGGAAAGAAGG - Intergenic
912026860 1:105187050-105187072 TTATAGATGAATGTGTGAGAAGG + Intergenic
912348195 1:108985536-108985558 TTCTTGTTTAGTGGGGAAGATGG - Intronic
912611105 1:111045244-111045266 TTATTTTTGAGTGACTAAGAAGG - Intergenic
913358022 1:117945409-117945431 TTATGGATAAATGGGGAAGATGG - Intronic
914332803 1:146687953-146687975 TAATAGATGAGTGGGGAAGGTGG + Intergenic
914967231 1:152270571-152270593 TTAGAGATGAGCGGGCAAGATGG - Intergenic
914969137 1:152291542-152291564 TTAGAGATGAGCGGGCAAGATGG + Intergenic
916120146 1:161522430-161522452 TTGGAGATGAGTGGGTAAGTGGG + Intronic
916129910 1:161604080-161604102 TTGGAGATGAGTGGGTAAGTGGG + Intronic
916921624 1:169474643-169474665 TTATTGAAGAGTAGGTAGGTAGG - Intronic
924012469 1:239680783-239680805 TTATTCATTAGTGGGAAGGAAGG - Intronic
924079232 1:240375850-240375872 TTATTTATCAGTTAGTAAGAAGG + Intronic
1064588225 10:16861706-16861728 TTATGGTGCAGTGGGTAAGAGGG - Intronic
1066008570 10:31171080-31171102 CTAGTGATGAGTGGAAAAGAGGG - Intergenic
1068919927 10:62472836-62472858 TTGTTGATGAATGGGTAATATGG + Intronic
1070513418 10:77181384-77181406 TTATGGATGAGTTGTTAACAGGG - Intronic
1071250385 10:83812688-83812710 TCAGTGGGGAGTGGGTAAGAGGG - Intergenic
1071795464 10:89000656-89000678 CTATTGATGAGGGGGTATAACGG - Intronic
1072921389 10:99579934-99579956 TTATTGATCAGTGGTGAAAACGG + Intergenic
1073685768 10:105752098-105752120 TTTTTGATAAGAGGGTAAGAGGG - Intergenic
1074980663 10:118617306-118617328 TTATTTGTGAGTGGGAAACAAGG - Intergenic
1075552906 10:123406227-123406249 TTATTGTTGGGTGAGTAAGTTGG + Intergenic
1079853982 11:25576903-25576925 TTACTGCTGAGTTGGGAAGAAGG + Intergenic
1081396584 11:42592955-42592977 TTTTTGATGAGATGTTAAGAAGG - Intergenic
1083002274 11:59303636-59303658 TTATTAATAAATGAGTAAGAAGG - Intergenic
1087361174 11:97161413-97161435 TTATAGAAGAGTGGGCAATAAGG + Intergenic
1087514196 11:99136537-99136559 TGAGCAATGAGTGGGTAAGATGG - Intronic
1088131770 11:106500223-106500245 TTATTGATAAGTGGGTTGAAGGG - Intergenic
1088563292 11:111137859-111137881 TTATTGATCAGTAGATTAGAGGG + Intergenic
1090747611 11:129719971-129719993 TTATTGATGACTAGGAAGGAAGG - Intergenic
1091126692 11:133106174-133106196 TTATTGTTAAATGGGTGAGAGGG - Intronic
1092454750 12:8633276-8633298 TCGGTGATGGGTGGGTAAGAAGG - Intergenic
1092760603 12:11807564-11807586 CTGTTGAAAAGTGGGTAAGAAGG + Intronic
1092882998 12:12902430-12902452 TTATTAAAGTGTGGTTAAGAAGG + Intronic
1093227975 12:16508255-16508277 TAATGAATGAGTGGGAAAGAAGG - Intronic
1093797885 12:23335608-23335630 TTATTGATGAGTATGTCACAAGG - Intergenic
1093873682 12:24323696-24323718 ATATTGAATAGTGGGTAAAAAGG + Intergenic
1094226278 12:28049653-28049675 TTATTGTTGATTGGGAAAAAAGG - Intergenic
1096363127 12:51005587-51005609 TTAATAAAAAGTGGGTAAGATGG - Intronic
1098602865 12:72353826-72353848 CTATTGATGGGTGTGTAAAATGG + Intronic
1099012085 12:77303413-77303435 TTATTGATTAGTGGCAAAGAAGG + Intergenic
1099151033 12:79114173-79114195 TGAAGGATGAGTAGGTAAGAGGG + Intronic
1099152168 12:79128005-79128027 ATATAGATGAGTGGATAAGTAGG + Intronic
1099985478 12:89658008-89658030 TAATTGATGTGTGCGTAGGAGGG - Intronic
1101219058 12:102617664-102617686 TTCTTGCTGAGAAGGTAAGATGG - Intergenic
1102407175 12:112683667-112683689 TCACTGCTGAGTGGGAAAGATGG + Intronic
1102747188 12:115259415-115259437 GTCTTGCTGAGTGGGCAAGAAGG - Intergenic
1103500183 12:121395716-121395738 TTATTGATGGGTGGGTGTGGTGG + Intronic
1104115776 12:125747833-125747855 TTATTGATGAATGGTTGATATGG + Intergenic
1110129850 13:71993831-71993853 TTGTTGATGAGTGTGTCATATGG - Intergenic
1111305986 13:86413343-86413365 TTATTGGTGAGTGAGGAAAAAGG - Intergenic
1112176494 13:97030558-97030580 ATATTGATCAGTGGGCATGATGG + Intergenic
1112260799 13:97876279-97876301 TTATAGATGAGCTGGTAAGGAGG - Intergenic
1112617235 13:101018202-101018224 CCATTGAGGACTGGGTAAGAAGG - Intergenic
1116509319 14:45724115-45724137 TTATGGATGAGTGAATAAAATGG + Intergenic
1120888487 14:89470879-89470901 TTATTGCTGAGTGGTAGAGAAGG - Intronic
1121895781 14:97645879-97645901 TCATTGATGAGTTGTGAAGAAGG + Intergenic
1128247031 15:66140142-66140164 TTGTTCAGGAGTGGGTATGAAGG - Intronic
1129163665 15:73762671-73762693 TTACTGCTTAGTGGGGAAGACGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129614905 15:77090708-77090730 TTATTCCTGAGTGGGTACAAGGG + Intergenic
1133646188 16:7766869-7766891 GTGTTGAGGAGGGGGTAAGATGG - Intergenic
1134505146 16:14799360-14799382 TTATGGGTGAGTGGGGAAGAAGG - Intronic
1134575430 16:15329550-15329572 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1134727015 16:16426942-16426964 TTATGGGTGAGTGGGGAAGAAGG - Intergenic
1134940422 16:18284913-18284935 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1138242906 16:55443239-55443261 TCATTGGTGAGTGGGCATGAGGG - Intronic
1138242916 16:55443399-55443421 TTATTGGTGAGTGTGTATGAGGG - Intronic
1139007119 16:62586509-62586531 TTATTCATGAGGGGGCATGAGGG - Intergenic
1140000811 16:71023288-71023310 TAATAGATGAGTGGGGAAGGTGG - Intronic
1147725348 17:42563313-42563335 CTGTTGAAGAGTGAGTAAGAGGG + Exonic
1149856535 17:60087923-60087945 TGGCTGATGAGGGGGTAAGAGGG + Intergenic
1151672205 17:75577323-75577345 GTATTGATGGGTGTGCAAGATGG + Intergenic
1152194868 17:78911732-78911754 TTTTTGATGAGTGAGTCAAATGG - Intronic
1153807109 18:8718338-8718360 GTATTGAGGAGCGGGTATGAAGG + Intronic
1156264444 18:35473587-35473609 TTACTGGAGAGTGGTTAAGAGGG + Intronic
1156399555 18:36728194-36728216 CTGTTGCTGAGTGGGGAAGAGGG + Intronic
1156732645 18:40213088-40213110 TTGTTCATCAGTGGGTAATATGG + Intergenic
1158592353 18:58788527-58788549 TTATAGATGAGGGGTTAAGGTGG - Intergenic
1158719823 18:59914951-59914973 TTATAGTCCAGTGGGTAAGATGG + Intergenic
1158981984 18:62771839-62771861 TTATTGATGACTGGTGAAAATGG - Intronic
1159225993 18:65536742-65536764 TTATTCATGGGTGGGTATGGTGG + Intergenic
1160692112 19:464966-464988 TCATAGATGAGTGGGTAGGTGGG + Intronic
930097882 2:47580773-47580795 ATATTAATGACTGGGTAGGAGGG + Intergenic
930926789 2:56827962-56827984 TTATTCAGGAGTGGATAGGAAGG - Intergenic
931634412 2:64328630-64328652 TTACTGAAGGGTGGGTAGGAGGG + Intergenic
933368881 2:81389918-81389940 TTATAGATGAGTTGGTGAGGAGG - Intergenic
937413446 2:121696376-121696398 TTGTTAATGAGTGGGTGAAAGGG + Intergenic
943216731 2:185046240-185046262 TAAATGATGAGAGTGTAAGAAGG - Intergenic
943286425 2:186007396-186007418 TTATTGTTTAGTGGAGAAGAGGG - Intergenic
943609024 2:190010163-190010185 ATATTCTTGAGTGGGTGAGATGG + Intronic
944057783 2:195541416-195541438 ATATTTAAGAGTGGCTAAGATGG + Intergenic
944319590 2:198322815-198322837 TGATAGAGGAGTGGGGAAGATGG - Intronic
944942689 2:204646631-204646653 TTATAGATGAGTGGATCATAGGG + Intronic
946919591 2:224564957-224564979 TACTTGATGATTGGATAAGAAGG - Intronic
948175798 2:235941842-235941864 TTGTTGTTGGGGGGGTAAGAAGG + Intronic
1170533896 20:17321364-17321386 GTATTGGAGAGTGGGGAAGAAGG - Intronic
1173502964 20:43566847-43566869 GTTTTGAGAAGTGGGTAAGATGG + Intronic
1173909432 20:46653441-46653463 CTAGTGATGAGTGGAAAAGAGGG - Intronic
1174864523 20:54123045-54123067 TTAATGTGGAGTTGGTAAGACGG + Intergenic
1175043580 20:56079898-56079920 TTATTGAAGGGAGGGTAAAATGG - Intergenic
1175169167 20:57067888-57067910 TTCTTGGTGTGTTGGTAAGAGGG - Intergenic
1178117930 21:29436476-29436498 GTATTGGTGAGTGGGAGAGAAGG + Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1184378751 22:44131887-44131909 TTATGGATGGGTGGATCAGAGGG + Intronic
955012384 3:55030992-55031014 TTCTTAATGTGTGGGGAAGAGGG + Intronic
955455872 3:59121204-59121226 TGATTGTTGAGTGGATTAGATGG - Intergenic
957288010 3:78241629-78241651 TTATTATTGAGTAGGTAAAAAGG + Intergenic
957630216 3:82708280-82708302 TGGCTGAGGAGTGGGTAAGATGG - Intergenic
957808005 3:85176270-85176292 ATATTTATGAGTTGGTGAGAGGG - Intronic
957984448 3:87555488-87555510 TTAATGATGGGTGGGTAAATTGG + Intergenic
958959015 3:100491802-100491824 TTTTTGATTAGTGAGTTAGAAGG - Intergenic
959771225 3:110099774-110099796 TTATTGATCAGTGGGAGAGTTGG + Intergenic
962473886 3:135739079-135739101 CTATTGAGGGGTGGGTAAGGGGG + Intergenic
964822980 3:160794304-160794326 TAGTTGATGAGTGGGGAAAAGGG + Intronic
966230775 3:177649139-177649161 TTATTGCAGAGGGGATAAGAGGG - Intergenic
967309163 3:188089769-188089791 GAATTCATGAGTGGGAAAGAAGG - Intergenic
968137376 3:196228792-196228814 TTCTTCCTGAGTGGGGAAGAGGG - Exonic
969258395 4:6018573-6018595 TTATTCATGAGTGGGTGACTTGG + Intergenic
974505536 4:62766023-62766045 TTGCTGATGACAGGGTAAGATGG + Intergenic
974511605 4:62849676-62849698 TTAATGATGAGAAGGTAAAATGG - Intergenic
974890095 4:67870989-67871011 TTATTAATGAGTTGGTAGGAAGG - Intronic
975291838 4:72686327-72686349 TCATTGCTGAATGGGAAAGATGG - Intergenic
975322909 4:73028296-73028318 CTTCTGATGTGTGGGTAAGAGGG + Intergenic
977547630 4:98402871-98402893 TTATAGTTTAGTGTGTAAGATGG + Intronic
979181986 4:117741358-117741380 TTCTTGATGTGTTGGTCAGATGG + Intergenic
980222595 4:129938827-129938849 TGATTGATGAGAGAGTCAGAGGG + Intergenic
982420296 4:155187728-155187750 TTATTGATGAAAGAGTAAAATGG + Intergenic
983717548 4:170803782-170803804 TTATTGGTGAGTGGAAAAGAAGG - Intergenic
985242023 4:187940704-187940726 TGAATGAGGAGGGGGTAAGAAGG - Intergenic
986702298 5:10422538-10422560 TTATAGACGACTGGGTAAAAGGG + Intronic
989059468 5:37396163-37396185 TTATTTTTGACTGCGTAAGACGG + Intronic
991157914 5:63459794-63459816 TTATTGGGCAGTGGGTAAAATGG - Intergenic
991219290 5:64193951-64193973 ATATTGATGAGAGGAAAAGAGGG + Intronic
992920174 5:81507796-81507818 TTATGGATGAGTAAGTAACAAGG - Intronic
992974720 5:82103051-82103073 TTAGGGATGAGTTGGGAAGATGG - Intronic
993492920 5:88573732-88573754 TTTTTAAGGAGAGGGTAAGATGG + Intergenic
998126790 5:139629333-139629355 TTTTTGGTGAGTGGGAAAGGTGG - Intergenic
1007076482 6:39070554-39070576 TTACTGATGAGAGGGTAAACTGG - Intronic
1007493150 6:42240008-42240030 TTAAGGAGGAGAGGGTAAGAGGG - Intronic
1018360996 6:163067782-163067804 TCATTAATTAGTGGGGAAGAAGG - Intronic
1018993460 6:168692421-168692443 TGATTGATGTGTGTGTCAGAAGG - Intergenic
1019918783 7:4149928-4149950 TTAGTGATGGCTGGGGAAGATGG + Intronic
1021960979 7:25872706-25872728 TCATTGATGAGTGGCCAAGTTGG + Intergenic
1024754756 7:52516598-52516620 TTATTGATGAGTGTGTGTGAGGG - Intergenic
1024841106 7:53588613-53588635 TTATGAATGAGTGGCTAAGGAGG + Intergenic
1028419420 7:90615580-90615602 TTTTTTTTGAGTGGGAAAGAAGG + Intronic
1028542026 7:91952981-91953003 TTATTGATGAGTGTTTAAGCTGG + Intronic
1032538565 7:132684883-132684905 TGGTGGATGAGTGGGGAAGAGGG - Intronic
1032918462 7:136518428-136518450 TTTTTGGTGAGTGGGGGAGAGGG + Intergenic
1033642147 7:143271564-143271586 TTATTGATCAGAAGGGAAGAGGG - Intergenic
1034384718 7:150730906-150730928 TTATTGATTACTGAGAAAGAAGG - Intronic
1036662991 8:10720333-10720355 TAATAGATGGGTGGGTGAGAAGG + Intergenic
1038006158 8:23432420-23432442 AAATTGAGGAGTGGGGAAGAGGG - Exonic
1038128627 8:24703499-24703521 TTATTCATGATGGGGTATGAGGG + Intergenic
1038208352 8:25490886-25490908 TTATTTAAGATTGGGTAAGTTGG - Intronic
1038505220 8:28078496-28078518 TTATTGATGGGTGGTAAAGCTGG - Intronic
1040705799 8:50125456-50125478 TTATTTATGAGTGTGTCACATGG + Intronic
1041012810 8:53560277-53560299 CTGTTGATGAGTGGGGGAGATGG - Intergenic
1041335303 8:56775393-56775415 TTATTTCTCTGTGGGTAAGAAGG + Intergenic
1044335250 8:90975685-90975707 TTACTGATGAGAAGGTAAAATGG + Intronic
1045038829 8:98201296-98201318 TAATTGATGAGTCGGTGGGATGG - Intronic
1045128906 8:99126041-99126063 ATATTCTTGAGTGGATAAGAGGG + Intronic
1045919240 8:107510739-107510761 TTATTGATGAGAGGATACCATGG - Intergenic
1050912736 9:11093789-11093811 ATATTACAGAGTGGGTAAGAGGG - Intergenic
1051017803 9:12502054-12502076 TCATTGATGAGTGTGTGTGATGG + Intergenic
1051623460 9:19076026-19076048 TGACTGATTAGTGGGTTAGAGGG + Intronic
1051944170 9:22546233-22546255 TTATTGATGAGGAAGCAAGATGG + Intergenic
1052421602 9:28250122-28250144 TTAACAATGAGTGGTTAAGAAGG + Intronic
1055129371 9:72756875-72756897 TTACTAATGAGTGGACAAGAGGG + Intronic
1055653974 9:78435557-78435579 TTATTGGTCAGTGGGTACGGCGG + Intergenic
1057994221 9:99805458-99805480 TTATTTATGAGTGAATGAGAGGG + Intergenic
1059073072 9:111159985-111160007 TTGTTGTTGAGTTGGCAAGATGG - Intergenic
1187761650 X:22593533-22593555 TTATTGATGAGTGAATTACACGG - Intergenic
1187958541 X:24544767-24544789 TTTTGGATGTGTGGGTCAGAGGG + Intergenic
1193325997 X:80179150-80179172 TTATGCATGAGGGAGTAAGAAGG + Intergenic
1193935871 X:87620524-87620546 TAATTGGAGAGTGGGTAAAAAGG + Intronic
1195302042 X:103539502-103539524 CTATTGCTGAATGGGTAATAAGG - Intergenic
1195401842 X:104469137-104469159 TTAGGGATGAGTGGTTAAAATGG + Intergenic
1196199849 X:112873681-112873703 TTATTGATGAGACAGTAAGGGGG - Intergenic
1196962300 X:121016099-121016121 TTGTTGGTGAGTGTGTAACATGG + Intergenic
1199589557 X:149454597-149454619 TTATTCATCAGTGGGTGAGTTGG - Intergenic
1199593322 X:149488054-149488076 TTATTGATGAGTGGGTAAGAGGG - Intronic
1199598696 X:149527377-149527399 TTATTGATGAGTGGGTAAGAGGG + Intronic