ID: 1199599542

View in Genome Browser
Species Human (GRCh38)
Location X:149533767-149533789
Sequence GCCTCTCATTAATCCCCTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199599542_1199599545 21 Left 1199599542 X:149533767-149533789 CCCACAGGGGATTAATGAGAGGC 0: 1
1: 1
2: 2
3: 5
4: 74
Right 1199599545 X:149533811-149533833 TAAAAATTAAGCAGAAACACTGG 0: 1
1: 1
2: 12
3: 112
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199599542 Original CRISPR GCCTCTCATTAATCCCCTGT GGG (reversed) Exonic
902715812 1:18271902-18271924 GCCTCTCAATGACACCCTGTTGG - Intronic
903453847 1:23473450-23473472 GCCACTCACTGTTCCCCTGTGGG + Intronic
903687480 1:25142515-25142537 GCCTCCCATTAGTCCCCTGTAGG - Intergenic
904590007 1:31608075-31608097 TCTTGTCATTAATCCCTTGTTGG - Intergenic
905935551 1:41821313-41821335 GCCTCTCATCAATCAAATGTAGG + Intronic
907589064 1:55648344-55648366 GTCTCTCATTCAGCCTCTGTGGG - Intergenic
924707813 1:246512880-246512902 GCCTCTCATCAGTCCCATGGGGG + Intergenic
1063601352 10:7483788-7483810 GCATCTCATTCACGCCCTGTTGG + Intergenic
1063842610 10:10089194-10089216 GACTCTCATAAAACCCCAGTAGG + Intergenic
1066573675 10:36802170-36802192 GTCTCCCACTAAACCCCTGTGGG - Intergenic
1069407035 10:68112552-68112574 GATTCTCATTAATTCCCTGATGG + Intronic
1072676689 10:97471929-97471951 AACTCTCATTAATCTTCTGTTGG - Intronic
1072708737 10:97701665-97701687 GCCTCTCACTAGGCTCCTGTGGG + Intergenic
1074568053 10:114599376-114599398 GACATTCATTTATCCCCTGTGGG - Intronic
1076300597 10:129423065-129423087 GCCTTTCATTGACCCCATGTGGG - Intergenic
1081631816 11:44694453-44694475 GCCTCTCAGCCTTCCCCTGTGGG - Intergenic
1085856572 11:80182106-80182128 GCCTCTCCTTCATCCACTCTCGG + Intergenic
1091094970 11:132811708-132811730 GGCTCTTATTAATTTCCTGTGGG - Intronic
1095619929 12:44240363-44240385 GACTTTCATTTATACCCTGTTGG + Intronic
1107883385 13:44853542-44853564 GCCTCACATTATACCCCTATTGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114939138 14:27584642-27584664 GCCTCTGTTTAAGCCTCTGTAGG - Intergenic
1202866739 14_GL000225v1_random:124856-124878 GTCTCTCACAAATCCCCTGTAGG - Intergenic
1125788362 15:42342842-42342864 GCCTGTCATTAATGCACTCTGGG - Intronic
1131425571 15:92342996-92343018 TCCTCTAATTAACCCCCTGAAGG + Intergenic
1131734870 15:95321351-95321373 TCTTGGCATTAATCCCCTGTTGG + Intergenic
1134741162 16:16548039-16548061 GCCTCTCTTTTCTCCTCTGTAGG - Intergenic
1134926337 16:18164089-18164111 GCCTCTCTTTTCTCCTCTGTAGG + Intergenic
1135870857 16:26148992-26149014 ACCTCTCATCAATCCCATTTAGG + Intergenic
1139356929 16:66372084-66372106 GCCTCTCACTGAGCCACTGTGGG - Intronic
1140114869 16:72033161-72033183 GCCTGCTATTGATCCCCTGTAGG - Intergenic
1140340567 16:74155674-74155696 GCGTCTCCTTAATCTACTGTAGG - Intergenic
1146302242 17:31698452-31698474 GGCTCTCATAAAGCCCCAGTAGG - Intergenic
1146790847 17:35749815-35749837 CCCTCTCATTTAACCCCTGCTGG - Intronic
1152031008 17:77843110-77843132 GCCTCTCGACAATCCCATGTAGG + Intergenic
1153261689 18:3230454-3230476 GCCTCTGATTTGTCCCCTCTGGG + Intergenic
1154168123 18:12031058-12031080 GCCTCTGATGAATACCCTGAAGG + Intergenic
1156557046 18:38079237-38079259 GACTCTCAGTATTCCCCAGTTGG - Intergenic
1161699147 19:5785459-5785481 GCCGCTCGTTGATCCTCTGTGGG + Exonic
929909809 2:46080121-46080143 GCTACTCATTAATCCCCTCTTGG - Intronic
937005319 2:118506906-118506928 GCCTCTCATTGAGCACCTCTGGG - Intergenic
937354375 2:121188770-121188792 GTGTCTCTTTCATCCCCTGTGGG + Intergenic
1170038207 20:12012390-12012412 GCCTGTCATTAACACACTGTTGG - Intergenic
1171309760 20:24136594-24136616 ACCTGTCATTTATACCCTGTGGG - Intergenic
1171373124 20:24674380-24674402 GCCGCTCACTGATCCCCTTTAGG - Intergenic
1174760397 20:53201482-53201504 CCCTCTCATAAAGCCCCTTTGGG + Intronic
1175649983 20:60712398-60712420 GTCTCTCTTTAATCTCCTTTTGG + Intergenic
1179374404 21:40836938-40836960 TCCTCTCATTAGCCTCCTGTTGG - Intronic
1179559768 21:42207932-42207954 GCTTCTCATTAGTGCCCAGTGGG + Intronic
1180754937 22:18154918-18154940 GCCTCTCCCTAATCTCCTATGGG - Intronic
954376581 3:50197111-50197133 GCCTCTGTTTGATCCTCTGTTGG - Intergenic
955133417 3:56192478-56192500 GCCTTACATCAATCCTCTGTGGG + Intronic
964464622 3:156977279-156977301 GCCTCTCATTGTTTCCTTGTTGG + Intronic
972195793 4:36652360-36652382 TCATCTCATTATTCCCTTGTTGG + Intergenic
972789047 4:42353007-42353029 GTCTCTCTTTAAGCCACTGTGGG + Intergenic
976289671 4:83404696-83404718 GGTTCTCATTAGTCCCTTGTGGG - Intergenic
983713151 4:170744755-170744777 TTCTCTCTTTAATCCCCTGAAGG + Intergenic
984499271 4:180537664-180537686 GACTCTGCTTAATCCCCTTTTGG - Intergenic
984982773 4:185299167-185299189 GGCTCTCATTCATTCCCTCTGGG + Intronic
986939822 5:12936681-12936703 GCCTCTGATTAATCACCCATAGG - Intergenic
1006365474 6:33612667-33612689 ACCTCTCTTTAATCACCTGTTGG + Intergenic
1010970382 6:82256824-82256846 GCCTCTTTGTAATCCCCTGTTGG - Intergenic
1012482461 6:99682219-99682241 GCTTATCATTAATCCACTGCTGG + Intergenic
1012646308 6:101686627-101686649 GTCTCTCATTTCTCCCATGTAGG - Intronic
1016562291 6:145410135-145410157 GTCTCTCATTAATCCTCATTTGG - Intergenic
1022024707 7:26436672-26436694 GCATCTGATTAATTCCATGTGGG + Intergenic
1022213482 7:28235070-28235092 GCCTTTCAGAAATCCCATGTTGG - Intergenic
1031440740 7:121791882-121791904 GCCTCTCTTTACTCCCCTCTTGG - Intergenic
1040587016 8:48753486-48753508 GTCTCTCATTAAAACCCTGATGG + Intergenic
1044799291 8:95937030-95937052 GCTTCTCTCTAATCCCTTGTAGG - Intergenic
1047279348 8:123431689-123431711 GCCTCTCATTGGTCAGCTGTGGG + Intronic
1047421017 8:124708346-124708368 GGCTCTCAGTAATCTCCTTTAGG + Intronic
1060063568 9:120483021-120483043 GCTTCTCATGACTCCCCTTTGGG - Intronic
1060525296 9:124316886-124316908 CCCTCTCATTTCTCCCTTGTTGG + Intronic
1203737573 Un_GL000216v2:151301-151323 ATCTCTCACAAATCCCCTGTAGG + Intergenic
1187712548 X:22068454-22068476 GCCTCTCATTTAGCCACTGGGGG + Intronic
1191715032 X:64188326-64188348 ACCTCTCATTAATCACCTGTAGG - Exonic
1193867237 X:86749057-86749079 ACCTCTCTTTAATTCCTTGTAGG - Intronic
1196197658 X:112852903-112852925 GCCTCTAATTAATATCCTTTTGG + Intergenic
1197788136 X:130221499-130221521 CCCTCTCATTCATCCCGAGTGGG + Intronic
1199599542 X:149533767-149533789 GCCTCTCATTAATCCCCTGTGGG - Exonic
1199651090 X:149946440-149946462 GTCTCTCATTAATCCCCTGTGGG + Intergenic
1201179072 Y:11329182-11329204 ACCTCTCACAATTCCCCTGTAGG + Intergenic