ID: 1199601095

View in Genome Browser
Species Human (GRCh38)
Location X:149541496-149541518
Sequence CTGTGTGTGGAGCAGTACAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199601095_1199601099 -4 Left 1199601095 X:149541496-149541518 CCCGTGTACTGCTCCACACACAG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1199601099 X:149541515-149541537 ACAGCGGCCCCACCTCAGTCCGG 0: 1
1: 0
2: 3
3: 8
4: 120
1199601095_1199601105 16 Left 1199601095 X:149541496-149541518 CCCGTGTACTGCTCCACACACAG 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1199601105 X:149541535-149541557 CGGTCTTCCCTGCCTCCCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199601095 Original CRISPR CTGTGTGTGGAGCAGTACAC GGG (reversed) Exonic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900778257 1:4600523-4600545 CAGCGTGTGGAGCATTTCACCGG + Intergenic
900796822 1:4713003-4713025 CTGTGTGTGGTGGATTCCACCGG - Intronic
903293887 1:22331688-22331710 GTGTGTGGGGGGCAGCACACAGG - Intergenic
903918671 1:26783958-26783980 CTGTGTGTGGAGCATTACCTAGG + Intergenic
905486762 1:38303439-38303461 CTGTTGGTGGAGCTGTAAACAGG - Intergenic
905825181 1:41021507-41021529 GTGTGTGGGGAGCAGTAGAGGGG - Exonic
905939886 1:41854467-41854489 CTGTGTCTGGAGCACTGCTCAGG + Intronic
906708455 1:47911921-47911943 CTGTGTGTGGCACAGAGCACGGG - Intronic
912099943 1:106192315-106192337 CTCTGTCTGGTGCAGAACACTGG - Intergenic
912313340 1:108645067-108645089 CTGTGTGTCGAGCAGTTGACAGG - Intergenic
920227809 1:204450792-204450814 CTGGGTGGGGTGAAGTACACAGG + Intronic
920367935 1:205457667-205457689 TTGTGTGTGGGGCAGGACATGGG - Intergenic
922167472 1:223128119-223128141 CTGTGTGGGGAGGAGCATACGGG - Intronic
923309933 1:232725537-232725559 CTCTGTGTGGGGCAATACAGGGG - Intergenic
924078665 1:240369055-240369077 CTGTCTATTCAGCAGTACACAGG - Intronic
1065749434 10:28872173-28872195 TTGTGTGTGGAGAAGTTCCCAGG + Intronic
1067075825 10:43181220-43181242 CTCTGTGGGGACCAGTACCCAGG - Intronic
1067769277 10:49111662-49111684 CTGTGAGTGGAGAGGTACAACGG - Intronic
1069557437 10:69407370-69407392 CTGTGTGTGGAGCAGTTCCCAGG - Intronic
1070553992 10:77514211-77514233 CTGTGGGTGCAGCAGCTCACAGG - Intronic
1070739205 10:78891608-78891630 GGGTGTGAGGAACAGTACACAGG - Intergenic
1073341036 10:102744502-102744524 CTGTGTGTGTAGGGGTACACAGG + Intronic
1074123037 10:110507447-110507469 CCTTGTGTGGAGCATTACGCAGG - Intronic
1075689244 10:124384703-124384725 CTGCCTGTGGGGCAGCACACTGG - Intergenic
1076223752 10:128756935-128756957 CTGTGTGTGAAGATGTAGACTGG - Intergenic
1076466979 10:130689596-130689618 CTGTGGTTGGTGCAGGACACAGG - Intergenic
1076768176 10:132648440-132648462 CTTGGTGTGGACCAGTTCACTGG + Intronic
1077543326 11:3157904-3157926 GTGTGTGTTCAGCAGCACACTGG + Intronic
1079058790 11:17229572-17229594 CTGTGTGTATAGCAATACTCAGG - Intronic
1086429980 11:86727375-86727397 CTATGTGTGGAGCTCTGCACTGG + Intergenic
1087629284 11:100631560-100631582 CTGTCTGTGGAGCAGAAGACAGG + Intergenic
1089095386 11:115915974-115915996 GTGTGTGTGTAGGAGAACACAGG + Intergenic
1091787235 12:3250565-3250587 CTGTGTGTGGAGCTGTGGGCAGG - Intronic
1105008763 12:132740243-132740265 CAGTGTGTGTAGCTGTGCACAGG - Intronic
1107495302 13:40920461-40920483 CTGTGTATGGAGCAGCAAAAAGG - Intergenic
1109464058 13:62704953-62704975 CTCAGTGTGGTGCAGTACAATGG - Intergenic
1112840589 13:103572924-103572946 CTCTCTGTGGAGCAATACATAGG - Intergenic
1116751602 14:48892732-48892754 TTGTCTGTGGAGCACTAAACAGG + Intergenic
1118010935 14:61609797-61609819 CTGTGGGTGGACCATTACAGGGG - Intronic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1119164787 14:72483269-72483291 CTCTGTGTGCAGCAGTGCACTGG - Intronic
1124049604 15:26184085-26184107 CAGTGTGTGGATCATTACAAAGG - Intergenic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1126567161 15:50112715-50112737 CTGTGTGAGGTTAAGTACACAGG + Intronic
1129468021 15:75734638-75734660 CTGTGGGTGGAGGATTACTCAGG + Intergenic
1130169370 15:81495922-81495944 CTGTCTGTGGGGCAGAAAACCGG + Intergenic
1130910892 15:88270106-88270128 CTGGGTGGGGAGGAGTCCACTGG - Intergenic
1130973305 15:88752732-88752754 CTGTGGGAGGAGGAGTTCACAGG - Intergenic
1130993737 15:88892558-88892580 CTGAGAGAGGAGCAGCACACAGG + Intronic
1132652569 16:1028303-1028325 CTGTCTGAGGAGCCCTACACGGG + Intergenic
1135176761 16:20236701-20236723 GTGTGTGAGGAGCGTTACACTGG + Intergenic
1135200422 16:20432642-20432664 CTCGGTGTGGAGCAGGACTCTGG + Intronic
1135200425 16:20432667-20432689 CTTAGTGTGGAGCAGGACTCTGG + Intronic
1136625781 16:31461470-31461492 CTGGGTCTGGAGGGGTACACAGG - Intronic
1138775813 16:59722925-59722947 CTGTGTTTTGAGTTGTACACAGG - Intronic
1147141416 17:38462775-38462797 CTGTGTGTGTAGCTGTGCATGGG + Intronic
1148795431 17:50194645-50194667 CTGTGTGTCGCGGAGTTCACTGG - Intronic
1148894278 17:50831041-50831063 ATCTGTGTGGAACAGGACACGGG - Intergenic
1149618212 17:58019854-58019876 CTGTGTGTGTATCTGTAAACAGG - Intergenic
1151863539 17:76784024-76784046 CTGTGTGTGGAAATGTACAATGG + Intergenic
1152193160 17:78900839-78900861 GGGTGTGTGGAGCAGCACAGGGG + Intronic
1155160322 18:23190093-23190115 CTCTGTGAGGAGCAGTTCAGTGG + Intronic
1157577757 18:48754983-48755005 CTGGGGGTGGAGGAGTGCACTGG + Intronic
1160417696 18:78722786-78722808 TTGTGTTTGGAGCACAACACAGG + Intergenic
1162594103 19:11613710-11613732 CTCTGTGGGAAGCAGTACAGGGG - Intronic
1162844710 19:13383279-13383301 CTGAGTGTGGAGCAGGAGAGAGG + Intronic
1165243192 19:34482748-34482770 CTGGGGGTGCAGCAGTGCACGGG + Intronic
1167768309 19:51498978-51499000 GTGTGTGTGGAGGAGTTCAAGGG + Intronic
1168299295 19:55394400-55394422 CTGGGTGTGGTGGAGCACACCGG - Intronic
926221847 2:10941554-10941576 CTGTGTGTGGGGCAAGACATGGG + Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
927637020 2:24824083-24824105 CTCTGTTTGGAGAAGTTCACAGG + Intronic
932789322 2:74639916-74639938 CTGTGTGTGGAGAAGTAGTGCGG + Intronic
936965976 2:118127987-118128009 CTGTGTGTGGAGGGGAACCCTGG - Intergenic
937223863 2:120357083-120357105 CTGTGTGTGGAGCACAAGTCAGG + Intergenic
937323046 2:120972366-120972388 CTGTGGCTGGTGCTGTACACAGG - Intronic
938276939 2:130035133-130035155 GTGTGTGTGCTGCAGTTCACAGG - Intergenic
939332243 2:140779776-140779798 GTGTGTGTGTAGCAGTGCAGAGG + Intronic
944399311 2:199307370-199307392 CTCTGTGTGGCTGAGTACACGGG + Intronic
946201654 2:218074020-218074042 CAGTGTGTGGAGCAGGGGACTGG + Intronic
949009628 2:241671132-241671154 CTGTGTGTTGATCACCACACTGG + Intronic
1168796830 20:615938-615960 CCGTGTGTGCAGCTGAACACTGG + Intergenic
1172105742 20:32516386-32516408 CTGTGTGCGGTGCAGTCCCCAGG + Intronic
1172126026 20:32625900-32625922 CTGAGGGTGGAGCGGTCCACTGG - Intergenic
1182088784 22:27579965-27579987 CCGTGTGTGGAACTGCACACAGG + Intergenic
1183014316 22:34973341-34973363 CTGTGTGTGGAGGAGGCCCCAGG + Intergenic
1183767007 22:39887351-39887373 CTGGGTGTGGTGGTGTACACCGG - Intronic
1184372388 22:44090692-44090714 CTATGTGTGGAGGATTACACAGG - Intronic
951704393 3:25528768-25528790 CTCTGTGTGGAGTAGTCCTCTGG - Intronic
951948420 3:28169434-28169456 GAGTGTGTTCAGCAGTACACAGG - Intergenic
952709744 3:36417416-36417438 TTGTGTGTGTATAAGTACACTGG - Intronic
956633273 3:71337163-71337185 CTGTGAGTGGAACAGGACACAGG + Intronic
960040836 3:113148530-113148552 CCGTGTGGGGAGCAGCAAACTGG - Intergenic
960781864 3:121328824-121328846 GTCTGTGTGGAGCTGTACAAAGG + Intronic
962659678 3:137588770-137588792 ATGTGTGTTGAGCAGGACAATGG - Intergenic
963566227 3:146934518-146934540 CTGTGTGAGGAGGACTCCACCGG - Intergenic
964410060 3:156388739-156388761 CTGTGAGTGGAGCTGCCCACAGG - Intronic
964954161 3:162331914-162331936 CTGTATGTGGGGAAGAACACGGG + Intergenic
967336316 3:188348476-188348498 CTGTATATTGAACAGTACACTGG - Intronic
967772702 3:193352755-193352777 CTGTGTCTGAAGCAGAAAACAGG - Intronic
971018885 4:22515410-22515432 CTTTGTGTGGAGCTGTAGGCAGG - Intronic
975743205 4:77450731-77450753 CTGTGTGTGGTGGTGCACACTGG - Intergenic
976491328 4:85674080-85674102 CACTGCGTGGACCAGTACACTGG - Intronic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
986032466 5:3906901-3906923 CTGGGTGTGGCAAAGTACACAGG + Intergenic
986648463 5:9941153-9941175 CTGTGTGTGGAGGGGTACCAGGG - Intergenic
997007486 5:129835411-129835433 CTGTTTTTGGAAAAGTACACGGG - Intergenic
999538295 5:152542908-152542930 CTGTGTGTGGGCCAGTACCATGG + Intergenic
999998271 5:157113106-157113128 CTGAATGTGGAGCATTTCACAGG - Intronic
1001559031 5:172657321-172657343 CTGTGGGTGGAGGATTACCCAGG + Intronic
1002292620 5:178210109-178210131 CTGTGGGGGGAGCAGGGCACAGG - Intronic
1002795505 6:468081-468103 CTGCGAGTGGAGCAGAACCCAGG - Intergenic
1002808336 6:601237-601259 ATGTGTGTGGATTCGTACACGGG - Intronic
1006368778 6:33632082-33632104 CTGTGGGTGGAGGATTACCCAGG - Intronic
1006450679 6:34104129-34104151 CTGTCTGTGGGCCAGGACACAGG + Intronic
1009863834 6:69370894-69370916 CAAAGTGTGGTGCAGTACACTGG + Intronic
1010291043 6:74138279-74138301 ATGTGTGTAGAGCAGATCACAGG + Intergenic
1011941497 6:92848648-92848670 CTGTGTGAGTAGCAGTGCATGGG - Intergenic
1013616808 6:111850970-111850992 TTGTGTGTGGAGCAAGACACAGG - Intronic
1015559421 6:134498451-134498473 CTGGGTGAGGAGGAGGACACTGG + Intergenic
1017643110 6:156513407-156513429 CTGTGTTTGGAGGACTCCACTGG - Intergenic
1019128733 6:169858783-169858805 CTGTGTGTGGAGCTGTGCCAGGG + Intergenic
1023042788 7:36186723-36186745 ACGTGGGTGGAGGAGTACACAGG + Intronic
1023410232 7:39882872-39882894 CTGTGTGAGGATCACTACAAAGG + Intergenic
1024118036 7:46211315-46211337 CTGAGTGTGGGGCATGACACAGG - Intergenic
1024143289 7:46483865-46483887 CTGTGTGTGCAGGAGAACACAGG - Intergenic
1032319803 7:130875520-130875542 CTGTGTTGGGAGCTGCACACAGG + Intergenic
1032446340 7:131986979-131987001 ATGAGTGTGGAGCAGTAGTCGGG + Intergenic
1032708854 7:134445203-134445225 CAGTGTGAGGAGCAGTTCCCAGG - Intronic
1033861026 7:145627987-145628009 GTGAGTGTGGAGCAGAAGACAGG + Intergenic
1034525225 7:151655395-151655417 CTGTGTGTGAAGTAGCACCCTGG + Intronic
1035637477 8:1157204-1157226 CCGTGTGTGAAGCAGTTCCCGGG + Intergenic
1035815776 8:2538539-2538561 CTGTGTGTGCAGCATCCCACTGG + Intergenic
1038695782 8:29805104-29805126 CTCTGTGTGCAGCAGCACAGGGG - Intergenic
1039311477 8:36322034-36322056 CAGGGTGTGGAGGAGTGCACAGG + Intergenic
1039560703 8:38510384-38510406 CAGGGTGTGGAGCAGTAAAAGGG + Intergenic
1041584515 8:59500055-59500077 CTGTGTCCACAGCAGTACACTGG + Intergenic
1043637930 8:82410436-82410458 CTGTGTGCAGAGAAATACACTGG + Intergenic
1045862788 8:106831709-106831731 CTGTGTGTAGAGGTGAACACTGG - Intergenic
1047119572 8:121885980-121886002 CCGTGTGTGGTGGAGCACACCGG + Intergenic
1048261888 8:132952227-132952249 ATGTGTGTGGAGCAGCAGAGTGG + Intronic
1048428205 8:134342258-134342280 CTGTGGGTGCAGCAATACATAGG - Intergenic
1049659337 8:143812723-143812745 CTGTGTGTGGTGTGGAACACAGG - Intronic
1051888240 9:21917140-21917162 CTTTGGGTGGAGCAGCACTCAGG + Intronic
1055873294 9:80911968-80911990 GTGTGTTTGGAGCAGTTCAAAGG - Intergenic
1056752495 9:89362684-89362706 CTGTGTGTGCTGAAGTACAGAGG + Intronic
1056781673 9:89555341-89555363 CTATGGGTGGAACAGTACCCAGG - Intergenic
1057686543 9:97239678-97239700 CTGTGTATGGAGCAGCAAAAAGG + Intergenic
1057953618 9:99389531-99389553 CTGGGTGTGGGGAAGCACACAGG - Intergenic
1059659022 9:116382883-116382905 CGGTGTCTGGAGCAGGAGACTGG + Intronic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1186225510 X:7395156-7395178 CTGTGTGTCTAGCAGTAGAGAGG + Intergenic
1189704006 X:43741974-43741996 TGGTGTGAGGAGCAGTACTCTGG + Exonic
1189707658 X:43775226-43775248 TGGTGTGAGGAGCAGTACTCTGG - Exonic
1190324219 X:49196783-49196805 CTGTGTGCCGGGCAATACACTGG - Intronic
1199601095 X:149541496-149541518 CTGTGTGTGGAGCAGTACACGGG - Exonic
1200246770 X:154530657-154530679 CTGTGTGGGGAGCAGTGCAGGGG + Intergenic