ID: 1199601612

View in Genome Browser
Species Human (GRCh38)
Location X:149544517-149544539
Sequence TCTATTAGGTGCCACGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199601607_1199601612 19 Left 1199601607 X:149544475-149544497 CCACGGGCCTGAGGGGTGAGGGC 0: 2
1: 1
2: 0
3: 34
4: 340
Right 1199601612 X:149544517-149544539 TCTATTAGGTGCCACGTACTGGG 0: 1
1: 1
2: 3
3: 18
4: 176
1199601608_1199601612 12 Left 1199601608 X:149544482-149544504 CCTGAGGGGTGAGGGCAGCCACT 0: 1
1: 2
2: 1
3: 26
4: 244
Right 1199601612 X:149544517-149544539 TCTATTAGGTGCCACGTACTGGG 0: 1
1: 1
2: 3
3: 18
4: 176
1199601609_1199601612 -6 Left 1199601609 X:149544500-149544522 CCACTATTTCTGACTGTTCTATT 0: 1
1: 1
2: 2
3: 26
4: 346
Right 1199601612 X:149544517-149544539 TCTATTAGGTGCCACGTACTGGG 0: 1
1: 1
2: 3
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199601612 Original CRISPR TCTATTAGGTGCCACGTACT GGG Intronic
900002568 1:22787-22809 TCTACAAGGTGCCAAGTACCAGG + Intergenic
900022287 1:193312-193334 TCTACAAGGTGCCAAGTACCAGG + Intergenic
902974412 1:20078610-20078632 TCTACTACGTGCCAGGCACTGGG - Intronic
903374204 1:22855504-22855526 CCCAGTAGGTGCCAGGTACTGGG - Intronic
904094231 1:27965336-27965358 GCTGTTATGTGCCAGGTACTGGG + Intronic
904356796 1:29945481-29945503 CCTATTACGTGCCAGGTTCTGGG - Intergenic
905847723 1:41246673-41246695 CCTATTATGTGCCAGGAACTGGG + Intergenic
908420424 1:63953619-63953641 CCTACTAGGTGCCAAGCACTGGG - Intronic
909114983 1:71522231-71522253 TATATTATGTGCTACATACTGGG - Intronic
914936729 1:151988162-151988184 TCTATTAAGTACCACGTACTGGG - Intronic
915375770 1:155393894-155393916 TCTATTATGTACCAGGTGCTGGG + Intronic
918126704 1:181590227-181590249 CCTTTAAGGTGCCAGGTACTAGG + Intronic
918256272 1:182751394-182751416 CCTATTAGGTGTCAGGTACCAGG + Intergenic
919781134 1:201221879-201221901 CCTACTAGGTGCTAGGTACTGGG + Intronic
920050171 1:203159743-203159765 CCTATCAGGTGCCAGGTTCTAGG - Intronic
920057098 1:203200806-203200828 CCTATTAGGTGCCAAGTCCTGGG + Intergenic
921444162 1:215225104-215225126 TCTATTATATGCCAAGTCCTGGG - Intronic
922129266 1:222760710-222760732 TTTATTATGTGCTAGGTACTGGG + Intergenic
1063786816 10:9394206-9394228 ACTATAAGGTGCCACAGACTGGG + Intergenic
1063877699 10:10497381-10497403 TCAATTATGTGCCAGGCACTAGG + Intergenic
1065298223 10:24296914-24296936 TCCTGTAGTTGCCACGTACTTGG - Intronic
1066654644 10:37686702-37686724 TGTTTTGGGTGCCCCGTACTGGG - Intergenic
1068345089 10:55765902-55765924 TCTATTATTTGCCAGGCACTAGG - Intergenic
1068650094 10:59513111-59513133 TCTATTATATGCCAGATACTTGG + Intergenic
1070372955 10:75802686-75802708 CTTATTATGTGCCAGGTACTGGG - Intronic
1070549749 10:77481799-77481821 ACTAACAGGTGCCAGGTACTAGG + Intronic
1070861474 10:79669035-79669057 TCTATTATTTGCCAGGCACTGGG + Intergenic
1071145542 10:82566104-82566126 CTTATTAAGTGCCACGTACTGGG - Intronic
1072222028 10:93334751-93334773 CCTACTATGTGCCAGGTACTAGG + Intronic
1074159470 10:110825309-110825331 TCAATTAGGTTCCAAGTTCTTGG - Intronic
1075609374 10:123839479-123839501 TCTAATAGGTGCCTGGTCCTGGG + Intronic
1075785259 10:125045143-125045165 TCTATTGGGTACTACGGACTGGG - Intronic
1075934549 10:126328227-126328249 CCTATTATGTGCCAGGTGCTAGG - Intronic
1080432764 11:32213940-32213962 TCTACTATGTGCCAGGCACTAGG + Intergenic
1080470209 11:32538203-32538225 TATCTTAGGTGCCACTTTCTGGG + Intergenic
1080720241 11:34841380-34841402 TCTACTAAGTGCCAGGTACCAGG + Intergenic
1080728370 11:34919792-34919814 TCTATTAGGTGCCAGGCACATGG + Intronic
1080784174 11:35459869-35459891 TCTATGAGGTACCAGGCACTGGG - Intronic
1081756071 11:45545451-45545473 CCTATTATGTGCCAGGCACTGGG + Intergenic
1083617752 11:64035024-64035046 TCTAATAGGTGCCAGGCACTGGG + Intronic
1083785605 11:64944415-64944437 TCTACTATGTGCCAAGTACCAGG - Intronic
1086193843 11:84112781-84112803 TCTATTAGGTGCTACTCCCTTGG + Intronic
1088297825 11:108319677-108319699 CCTATTATGTGCCAGGCACTAGG - Intronic
1088562386 11:111128492-111128514 TCTACTATGTGCCAGGCACTGGG - Intergenic
1088888387 11:114025463-114025485 TATATTAGGTGCCTCATACATGG - Intergenic
1089947713 11:122494885-122494907 TCTACTATATGCCAGGTACTGGG + Intergenic
1091375986 12:24850-24872 TCTACAAGGTGCCAAGTACCAGG + Intergenic
1092035574 12:5331908-5331930 TCTAATAAGAGGCACGTACTTGG - Intergenic
1092161986 12:6320311-6320333 TGTATTAGGTCCCACAAACTTGG + Intronic
1093583429 12:20808514-20808536 TCTATAATGTGCCAGGTACTGGG + Intergenic
1094709277 12:32945079-32945101 TTTATCAGGTGCCAGGTTCTGGG - Intergenic
1095818009 12:46445971-46445993 CCTATTATGTGCCAGGTTCTAGG + Intergenic
1097983565 12:65758908-65758930 TCAATTTGGTGCCACCTAATTGG + Intergenic
1098405217 12:70117878-70117900 TCTATTATGTGCCAGGCACTAGG - Intergenic
1099048724 12:77757003-77757025 TCTATTAGGTGGCACTTGCTAGG + Intergenic
1100343869 12:93708128-93708150 TCTGTTAGGTGCCAGGCCCTGGG + Intronic
1100462496 12:94815090-94815112 TCTTTTATGTGCCAAGCACTGGG + Intergenic
1100888042 12:99094122-99094144 TTTATTATGTGCCAGGCACTGGG + Intronic
1101019552 12:100539666-100539688 CCTATTATGTGCCAGGAACTGGG + Intronic
1101359259 12:104010616-104010638 TCTACTATGTGCCAGGCACTGGG - Intronic
1107104600 13:36629900-36629922 TCTATTAAATGCCAAGTTCTGGG + Intergenic
1110620026 13:77584980-77585002 CCTACTAGGTGCCAGGTACTTGG - Intronic
1111665713 13:91266259-91266281 ACTTGTAAGTGCCACGTACTGGG - Intergenic
1117652995 14:57925884-57925906 TCTATCATGTGCCACTTCCTGGG + Intronic
1117663354 14:58031076-58031098 TCTAATAGGTACCAGGTACTGGG + Intronic
1117983960 14:61368939-61368961 TCTAATATGTGCCAGGCACTGGG + Intronic
1118422494 14:65622340-65622362 TCTATAATGTGTCACGCACTAGG - Intronic
1118904304 14:70012343-70012365 TCTACTATGTGCCAGGCACTGGG + Intronic
1119709084 14:76808369-76808391 TCTATTAGATGCTAGGTGCTGGG - Intronic
1121540092 14:94719109-94719131 TCTACTTTGTGCCAGGTACTGGG - Intergenic
1122255995 14:100476921-100476943 CCTATTATGTGCCAGGAACTAGG + Intronic
1127983208 15:64049152-64049174 TCTACTAAGTGCCAGGTGCTTGG - Intronic
1132450942 15:101968152-101968174 TCTACAAGGTGCCAAGTACCAGG - Intergenic
1134915190 16:18063369-18063391 CCTATTATGTGCCATGCACTGGG - Intergenic
1135190739 16:20352431-20352453 CCTATTATGTGCCAGGTACCAGG - Intronic
1135997091 16:27258692-27258714 TCTCTTATGTGCCAGGTGCTTGG - Intronic
1137720796 16:50626239-50626261 TCTGTTGGGTGCTAGGTACTAGG + Intronic
1137780832 16:51096498-51096520 CCTACTAAGTGCCAGGTACTAGG + Intergenic
1140834110 16:78777712-78777734 CCTATTATGTGCCAGATACTAGG + Intronic
1147127281 17:38380244-38380266 CCTGTTAGATGCCAGGTACTTGG + Intronic
1147478710 17:40738581-40738603 TCTATAAGGTGCCTGGTACCTGG - Intergenic
1147553547 17:41462100-41462122 TCTACTATGTGCCACGTACAGGG + Intronic
1147638349 17:41977981-41978003 CCTACTAGGTGCAAAGTACTAGG + Intronic
1149553304 17:57555706-57555728 CCTATTATGTCCCAGGTACTGGG - Intronic
1150559642 17:66283429-66283451 TCTACTATGTGCCAGGTACTGGG + Intergenic
1151063314 17:71121842-71121864 TCTATAATGTGCCATGTGCTAGG + Intergenic
1155435820 18:25811764-25811786 TCTATTGTTTGCCAAGTACTGGG - Intergenic
1156980294 18:43278690-43278712 TCTATTTGCTCCCACATACTTGG + Intergenic
1157602739 18:48904114-48904136 CCTATTAAGTGCCATGTCCTAGG - Intergenic
1158130936 18:54151966-54151988 GCTATTACGTGCCAGGCACTGGG + Exonic
1160634320 19:64395-64417 TCTACAAGGTGCCAAGTACCAGG + Intergenic
1165715552 19:38043622-38043644 TTTACTATGTGCCAGGTACTAGG - Intronic
927652988 2:24923405-24923427 TCTACTAGGTGCCAGGTACTGGG - Intergenic
928001291 2:27524910-27524932 TCTTTTAGTTGCCAAGTACGTGG + Intergenic
928335777 2:30396740-30396762 TCTATTTTGTGCCAGGCACTGGG + Intergenic
929608705 2:43253759-43253781 TTTAATAGCTGCCATGTACTTGG - Intronic
931657863 2:64525917-64525939 TCTGCTAGGTGCCATTTACTGGG - Intronic
932346957 2:71001774-71001796 TCTTTAAGGTGCCACATGCTGGG + Intergenic
932907171 2:75766772-75766794 GCTATTATGTGCCAAGCACTGGG - Intergenic
933704565 2:85280108-85280130 TCTATTGGGTGCCAGCTCCTTGG + Intronic
935191051 2:100779204-100779226 TCTCTAGGGAGCCACGTACTGGG - Intergenic
935447068 2:103168050-103168072 GCTATTAGATGCCTCTTACTTGG + Intergenic
936567155 2:113590632-113590654 TCTACAAGGTGCCAAGTACCAGG - Intergenic
940137468 2:150455006-150455028 CCTATTAGGTTCCAGGTACTGGG + Intergenic
941283932 2:163585561-163585583 CCTAATATGTGCCAAGTACTGGG - Intergenic
942969273 2:181938271-181938293 TCTATTGTATGCCAGGTACTTGG + Intergenic
946478059 2:220028161-220028183 TCTATTAGGTTCCAGGAACTAGG + Intergenic
947550303 2:231040706-231040728 TGGATTAGGTACCACGAACTGGG - Intronic
1168873436 20:1151582-1151604 TCCATCATGTGCCACTTACTGGG + Intronic
1168964624 20:1891925-1891947 TCTGCTAGGTGCCAGGCACTGGG - Intergenic
1169712268 20:8578184-8578206 TATATTATGTGCCAAATACTGGG - Intronic
1173148420 20:40545223-40545245 ATTATTAGGTGTCAGGTACTGGG - Intergenic
1173185676 20:40838170-40838192 TCTACTAGGTGCCAAGTTCCAGG + Intergenic
1173262052 20:41445341-41445363 TCTACTATGTGCCATGCACTGGG + Intronic
1174266903 20:49338541-49338563 CTTATTATCTGCCACGTACTGGG + Intergenic
1179032254 21:37730883-37730905 TCTATTATGTGCCAAGTACTGGG + Intronic
1181155002 22:20914468-20914490 TGTATTATGTGCTAGGTACTGGG + Intergenic
1181687504 22:24539688-24539710 TCTACTAGGTGTCAGATACTGGG + Intergenic
1181764006 22:25078201-25078223 CCTATTATGTGCCAGGCACTGGG - Intronic
1181947331 22:26528388-26528410 TCTACTATGTGCCAGGTGCTGGG + Intronic
1183261210 22:36797109-36797131 TCTTTTTGGTGCCAGGTTCTGGG + Intergenic
1183972226 22:41486224-41486246 TCTATTATGTGCCAAGCAATAGG - Intronic
1184299137 22:43544628-43544650 TCTCTTGGCTGCCACGTTCTTGG + Intronic
1184925742 22:47635860-47635882 TCTACTATGTGCCAGGTGCTAGG - Intergenic
951076552 3:18400547-18400569 TCTACTATGTGCCAAGCACTGGG + Intronic
952228959 3:31409199-31409221 TCTTTTAGGTTGCACGGACTAGG + Intergenic
953288066 3:41632484-41632506 TCTTTTATGTGCCATGCACTGGG + Intronic
955994492 3:64665968-64665990 TCGATTTTGTGCCAAGTACTGGG + Intronic
957887589 3:86308586-86308608 TCTATTATGAGCCTAGTACTAGG - Intergenic
962039615 3:131692353-131692375 TCTATTATGTGCCAAGTATCAGG - Intronic
964549014 3:157866036-157866058 TCTATTAGGAGCCGTGTACTGGG - Intergenic
964718409 3:159747097-159747119 TCTACTATGTGCCAGGTACTGGG - Intronic
965644289 3:170863690-170863712 TTTATTATGTGCCAGGGACTGGG - Intergenic
966298213 3:178448716-178448738 CCTACTATGTGCCAGGTACTAGG + Intronic
967066676 3:185923577-185923599 TTTATTAGTTGCCACCTATTGGG - Intronic
968424545 4:513597-513619 TCCACTAGGTGCCAGGTACCAGG - Intronic
969528658 4:7717441-7717463 TCTATTATGGGCCAGGTAGTGGG - Intronic
970309831 4:14770431-14770453 TCTGTTAAGTGCCAGGTACTGGG - Intergenic
970309869 4:14770922-14770944 TCTGTTAAGTGCCAGATACTGGG - Intergenic
976161802 4:82209500-82209522 TTTATTATGTGCCAAGCACTGGG - Intergenic
976337830 4:83911241-83911263 TCTATTATGTGCAAGGTGCTGGG + Intergenic
977207925 4:94184398-94184420 CCTCTTATGTGCCAGGTACTGGG + Intergenic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
981765580 4:148245216-148245238 TCTACAATGTGCCAGGTACTTGG + Intronic
986097939 5:4578646-4578668 TGTATTAAATGCCACTTACTAGG - Intergenic
988670087 5:33371945-33371967 ACTATTGTGTGCCACATACTGGG + Intergenic
990297142 5:54413663-54413685 TTTATCATGTGCCAGGTACTGGG - Intergenic
990792533 5:59496957-59496979 ACTCTTAAGTGCCACCTACTGGG + Intronic
992596709 5:78354406-78354428 TTTATTGTGTGCCACGTACTTGG + Intergenic
992606830 5:78466212-78466234 TATATTACGTGCCAGGCACTGGG + Intronic
993264306 5:85703920-85703942 TCAATTAGGTGAAATGTACTGGG + Intergenic
997755822 5:136398540-136398562 TCTTCTAGGTGCCAGATACTGGG + Intergenic
998605203 5:143626724-143626746 TCTACTAGGTGCCAAGCAGTGGG + Intergenic
999241876 5:150132623-150132645 CATATTAGGTGCCAGGTGCTGGG - Intronic
999370969 5:151055137-151055159 TGTATGAAGTGCCACGAACTGGG + Intronic
999461950 5:151764928-151764950 GCTATTATGTGCCAGGCACTTGG - Intronic
999581894 5:153048362-153048384 TCTCTTAGGTGGCAAGTACCTGG - Intergenic
1000045347 5:157517708-157517730 TCTATTATGTGCCAAGCACCTGG - Intronic
1003123536 6:3337369-3337391 CCTTGTAGGTGCCAGGTACTGGG + Intronic
1003387742 6:5684682-5684704 TCCTTTAGGTGACAGGTACTGGG - Intronic
1004083342 6:12418485-12418507 CCTATTAGGTGCCTGGTACATGG - Intergenic
1008303105 6:49866957-49866979 TCTATAATGTGTCACATACTTGG + Intronic
1011003496 6:82618076-82618098 TCTAGTATGTGCCAGGCACTTGG - Intergenic
1011581645 6:88873494-88873516 TCTGTTATGTGCCAAGTACCAGG - Intronic
1013034405 6:106366514-106366536 TCTGTTATCTGCCAGGTACTAGG - Intergenic
1013967907 6:115977584-115977606 TCTAATAGGTGCCAGGTCCTAGG + Intronic
1014020789 6:116586677-116586699 TCTATTATGTGCAAGGCACTAGG - Intronic
1014671991 6:124315956-124315978 CCTCTTAGGTGCAGCGTACTAGG - Intronic
1015608264 6:134984317-134984339 TGTATTATGTGCCAGGCACTGGG + Intronic
1016591103 6:145744166-145744188 TCTATTAAGTGCTAGGCACTGGG + Intergenic
1020040099 7:4995460-4995482 GCTGTTATGTGCCAGGTACTGGG + Intronic
1025837109 7:65104543-65104565 TTCATTATGTGCCAAGTACTGGG + Intergenic
1025906889 7:65794053-65794075 TTCATTATGTGCCAAGTACTGGG + Intergenic
1039226561 8:35394940-35394962 TGTATTAGGTGTCAAGCACTGGG - Intronic
1039715121 8:40099884-40099906 TTTATTAGGTGTCAAGCACTGGG + Intergenic
1044657961 8:94567877-94567899 TTTAGTATGTGCCATGTACTAGG - Intergenic
1045333781 8:101180253-101180275 TCACCTAGGTGCCAGGTACTGGG - Intronic
1046309173 8:112412767-112412789 TCTATGATGTGCCAGGAACTGGG + Intronic
1049885376 9:22900-22922 TCTACAAGGTGCCAAGTACCAGG + Intergenic
1051730351 9:20135981-20136003 TCTACTATGTGCCAGATACTAGG + Intergenic
1051999434 9:23259240-23259262 TCTTTTAGGTGCTGGGTACTGGG - Intergenic
1052983396 9:34466061-34466083 TCTACTATGTGCCAGGTCCTCGG - Intronic
1055733866 9:79307441-79307463 TCTATTATGTGCCAGCCACTAGG + Intergenic
1057518598 9:95742094-95742116 TATGCTAGGTGCCAAGTACTGGG + Intergenic
1060035985 9:120256177-120256199 TCTTCTAGGTGCCAGGCACTGGG - Intergenic
1186959873 X:14724286-14724308 CCTATTATGTGCCAGGTACGTGG - Intronic
1188368474 X:29339362-29339384 TCTACTATGTGCTAAGTACTAGG - Intronic
1189924096 X:45934562-45934584 TCTACTAAGAGCCACATACTAGG - Intergenic
1195718977 X:107847697-107847719 TCTATTAGGTGGCAAGCACCCGG + Intronic
1196238271 X:113308400-113308422 TCTATTATGTACCATGTATTTGG - Intergenic
1197001773 X:121448490-121448512 CCTATTACGTTCCAGGTACTGGG - Intergenic
1197270427 X:124419049-124419071 TTTACTAAGTGCCAGGTACTGGG - Intronic
1197335986 X:125210068-125210090 CCTATTCGGTGCTAAGTACTGGG + Intergenic
1197388950 X:125837179-125837201 ACAATTATGTGCCACTTACTGGG - Intergenic
1199601612 X:149544517-149544539 TCTATTAGGTGCCACGTACTGGG + Intronic
1199648764 X:149934966-149934988 TCTGTTAGGTGCCACGTACTGGG - Intronic
1200292854 X:154888222-154888244 TCTATGATGTGCTCCGTACTCGG + Intronic
1200339700 X:155383962-155383984 TCTATGATGTGCTCCGTACTCGG + Intergenic
1200346770 X:155456731-155456753 TCTATGATGTGCTCCGTACTCGG - Intergenic