ID: 1199603967

View in Genome Browser
Species Human (GRCh38)
Location X:149561754-149561776
Sequence CAGGGTCCCCAAAATGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199603967_1199603973 13 Left 1199603967 X:149561754-149561776 CCCATTTCATTTTGGGGACCCTG No data
Right 1199603973 X:149561790-149561812 TCCCTTCCGTCTCCCACTCCAGG No data
1199603967_1199603975 14 Left 1199603967 X:149561754-149561776 CCCATTTCATTTTGGGGACCCTG No data
Right 1199603975 X:149561791-149561813 CCCTTCCGTCTCCCACTCCAGGG No data
1199603967_1199603980 28 Left 1199603967 X:149561754-149561776 CCCATTTCATTTTGGGGACCCTG No data
Right 1199603980 X:149561805-149561827 ACTCCAGGGAATTTCAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199603967 Original CRISPR CAGGGTCCCCAAAATGAAAT GGG (reversed) Intergenic
No off target data available for this crispr