ID: 1199604223

View in Genome Browser
Species Human (GRCh38)
Location X:149563747-149563769
Sequence TTCAGTTTTCTCTTTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199604223_1199604227 18 Left 1199604223 X:149563747-149563769 CCTTCTTGAAAGAGAAAACTGAA No data
Right 1199604227 X:149563788-149563810 GTGGATAGTAGAGTTAGTGGTGG No data
1199604223_1199604228 23 Left 1199604223 X:149563747-149563769 CCTTCTTGAAAGAGAAAACTGAA No data
Right 1199604228 X:149563793-149563815 TAGTAGAGTTAGTGGTGGAGAGG No data
1199604223_1199604229 26 Left 1199604223 X:149563747-149563769 CCTTCTTGAAAGAGAAAACTGAA No data
Right 1199604229 X:149563796-149563818 TAGAGTTAGTGGTGGAGAGGTGG No data
1199604223_1199604226 15 Left 1199604223 X:149563747-149563769 CCTTCTTGAAAGAGAAAACTGAA No data
Right 1199604226 X:149563785-149563807 TGAGTGGATAGTAGAGTTAGTGG No data
1199604223_1199604230 27 Left 1199604223 X:149563747-149563769 CCTTCTTGAAAGAGAAAACTGAA No data
Right 1199604230 X:149563797-149563819 AGAGTTAGTGGTGGAGAGGTGGG No data
1199604223_1199604225 -1 Left 1199604223 X:149563747-149563769 CCTTCTTGAAAGAGAAAACTGAA No data
Right 1199604225 X:149563769-149563791 AATGATGGTGTACAAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199604223 Original CRISPR TTCAGTTTTCTCTTTCAAGA AGG (reversed) Intergenic
No off target data available for this crispr