ID: 1199604228

View in Genome Browser
Species Human (GRCh38)
Location X:149563793-149563815
Sequence TAGTAGAGTTAGTGGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199604223_1199604228 23 Left 1199604223 X:149563747-149563769 CCTTCTTGAAAGAGAAAACTGAA No data
Right 1199604228 X:149563793-149563815 TAGTAGAGTTAGTGGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199604228 Original CRISPR TAGTAGAGTTAGTGGTGGAG AGG Intergenic
No off target data available for this crispr